Description :
From Genome Similarity Track
Location :
Scaffold_55:239677- 242360
Sequence
2683 bases(100 bases per row)
CTAGCAAAAAATGATATTACCACACTAAAATTCTGTGAACGATCTACCTCTGTTCATCATTCTTCATTTTCAGATATCGCACATGCAAGCCTTTACTTAC
TAAATAAACATAAGAAATCAGCTAGCAAATTTCACTGCAGCAACTCGTAATTTCACCTTCCTTATCTTAATCAAGTACTTGTTATGCTGCGCCAGGGATA
TCTCCCTCGATTGATTGCTTCTAAAAAAACCATATACAAGTTTTAAGAACATCAAAAAACCGCCTTCCAGCTCTCTTTATATTGGTGAGAAGTGATAAAA
TTGCGGTGTTAATTACAATTGAAGATAAGCAAAAATTATATTGCTCTACCTTTACACCTGCACCATAGGTGTCGCTTTTTGAAGGCCTCTGACTGCGACG
TGTAGAGAGTGTGAGTTACACGCGCACTTATTCCCGCTCATGATTGGCTTCAGAGCGACCAAAGGTATTCAGATAGTTTATTCGAAGATGATCGACCCTT
CGGCAACGAAATTATCGCGCCTTTCTCAAAGAGTGAATGTAAAATAGTTTTATTTTAATTTTTTTATGAATATGAAAGTTCCCCGTCATTTACAACATGT
TGGTCAATGTACTTTAAAATAAAGGTATTCTGCATTCTTTTAGGCCTGTGCTGGTGGCGTATCGTCCCAGTATGCGCTGGCCGAGAAAGGAACACTTAAT
ACCCCGTCGATTATAAAGTTTAGACCCGGCGTCGAATGCAAAGCATCTAGGCCACCGATTGTCAAGTGCGAGGACTTAAACTACATCTTATTCAATTGCG
AGCACCGCAATATGTACCCAGCGATTTAACATGCCTGTAAAAAAATTGCAGCTATGACTAGACGCATCTTTTAACTTGAAGAACACTAGATTGCCTGCAC
ATAATTGGAAAATATCCGTAAAATAAATATGATCAAGGAATAGTTGCAAAAGGTGACAGGATTTAAAAGCTTCACCAATATGTGACAGGATTTAAAAGCT
TCACCAAAATGTGACAGTATATACTTTAGATACAAATATTTTTTAGTTTATCACACACCCATAAATTACGTCAGTGACCAGTAGGTACAGGGTACCGCTC
TTGGCGGTACAGAGTACCAATACGATAAAGGACCAGGAGGTTTATTCTGCAAGAGGAGGAGTTGTATGCACTCTAGCGGAGTGGTGCATGCCCCAGTGTC
CTGTGCTGGGAAGTGTGGGTTTGATTCCGACGTGGGTGCCGCCAAAGGTATCTCGTGACAGCTTGCGGTAATTGTCTTGTACATATTTTTATTCGGACCT
GGACATAATAAAGAGTCTGGAGCAGCTCACTTTATTCTAGGTTAATAGTATTGTGAGTCCTTTAGGTCAGACCGGTTCATCGCTGGAGGTAGAACGCACT
ACCCTAACAATAATGACAAGTGATCGCTTCGAGAAAGTTAAATGGGATTGTTCCCTGGGTGCATAAATTCTCGGTTGGCAAGTCACAAAACCTTTGTACC
AAGAGTCACAGAATTATATAAGTAGTGTAATGTGAAGAGAATGACATGACTTTTTTATGTTAGGACTTAACAAGGCGGAAGGTCGCACGGCTGTGTCCAT
AAGTGCTACCACACTTCCCGCACTGGTACGGTCTACGCACCCGGTCGCCAGATTCTTTTTCCCGCGATCTTATGCTTCCTTTCTTGGGTCTTCCCGCCGG
AAGGATATATTTGCTGGTGGAAAGCCTTAGTTGTTGACAATAAAGTGATCCTCGGGAATCAGCATGGCACCGACAGTTGTTTGATAAGTCGTGACTTAGT
AGCACTGATCTGTTAGCACTGATAGCTCAAACATTTTGTTCCTCGCATTGAGCGCCGCGACAAGACGACGACCTGCAATCTTCAACCTCAGCCAAGTCTC
ACACGAGCAAATCATTGCGGTCGTATCAATTTCTTGCTGCTTCAATGGCTGAGAGACACGGCAGAAAAAGGAAACGTGTTTACCACGGCCTACTGAAGTG
CACTCTTCGGCTTGCTTCAGCTGGTCTGGAATTTGACCTAGCTCGAGGAGTGACCACTCGTCCTAATTTTGCTTACAGTTGTACGTGCTGATTGCGAGTG
TACACATCACCCATTAGTATAGTTACATAGCTCTTAAAGCACTTGAAGGGTATTATCATTCGGGGTTTCAACTTCAAGCTCGTTTGCGGCTGTGTTATTA
ACTGAAAAATATCTAGGTTTTAAAAATATCCTGTCACGTTCTGGTGAAACTTTTGAATCCTGTCACCTATTGCAATTATCCCTAATTTTAAAAGAAGGCA
TCATACTACTTACCGGCATGTACCGTATAATATTTCCTGTTTTTGTCTATAAAAGTTATCTTTTCCATACAGACAAACATATCGACAAAAATTGCTTTAT
TTGGAATAAAGAATTTTTTTTCATTAAACATCTTTCCCTCTTCGTGGCAGAGGTTTGCGCACTCTTAATATATTTTCGCTTAGTCTGTAATTAATTAATT
TTGTAGGGACCAATTTGAGGTTGAAGCCTTAAACGGGTACGATGATAATCTGTCTCCCTTTTTTTTAACTTCCTTACGAGATCAAGAACATCACTATTAA
TATTTAGCACACTCAATCTATAGGCACATTCATTACGTCTGATACACAACGCACACCCGATTCTCCAGCCGGCTCCCAAAACC