Description :
From Genome Similarity Track
Location :
Scaffold_6:2396612- 2398038
Sequence
1426 bases(100 bases per row)
AAATCACGGTGATTAGCCCATCATTGAGTTAGGAGGCTAACTCGTCGATTTAAGATAGAATAAGGGTAACTGAACCATTTTTCGGCCGCTTCCTAATTCC
GGCCACGTTAACCACACAAATCCTGGTTCATACAGAAATCAGGGAACACAAAGCTGCATTGCTAGATTGAGGATTAGACCTGTGGGGCTGGCGTGAATGC
AAAATTATATCTAGAGCTAGCTCTGCATCGAAGTTTGGGTAGCGTCGGACAAGAATCGAGGTCGATAGCGCGAGCTGAAGTGGCTCCATAGTAAAGTGCA
CGGGATAAGTTGACCAGGAGCATGCACTTGGAGCACATATGCAAATCGTATGTTTTCTCAATACTAAACTTAAGTCAAGCCCGATGGTATCATGGAGGCG
ACTGAAATAGTTGGCTACAGCTCAGCACCAAAAGCATTGTTTTGATATCCAAAGCTTTGTATAGATTTGCAAGACGTCACTCGTGGTTGTAGTCCTGCCC
GTTATTTCCCTAAGAATGTTTATTCGCCGAAATTAGTTGCCAAAGTTCGCTTTTGCGGATTATGGGTCATCTGATTCAGTTTGATTTGCTCTTTGTATCG
ACAGGTGGCCGAAAAAAGGGAGGCGATTGAAAATAATCTCAATCGAAGCATAATGTTCGCTCGTCGATCTTATCACATGCCTCGCTCCACATAAGCTATA
AGTTGTACACGAGGTAGAGGAGATTCTACTCTTTATAATGGCGGCTTTCAAGCCGAAATTGACGCAGCCGTTAGAAAAAAACTTATATTAAAATTAGGTG
GCCGAAAACCGGTCGCATTACCCTTAGCTGCTAAGACAACGAGTTAACGTTGAGTTATGCTCACTTTCGTTGAATGGCTGGAGTAAATCCGTCAATACTA
CGGCCCTGACATTCTAATTCTAACTCGCTCGCTTTGTCGGATTGCTTTTTAGTCGATGATTGACATGCGTTGGCGATCTATCGTACTAAACTACGTCTAC
AATATTGAAGAACATCCCTGTTTTTATATCGAGGAGCTGCAAGCAGCTTTAAAGTCAGCGTTTCCTGCACTATCAAACATTTCTAGTAGAAATTTTCTAC
TGCTACTATATGCCGTGCTCTGAAATTCGAGCTTGGTTTAACGCGCAAGGCCACGACGAAGAGAGCGAAAGAAAACGTCCCGCCGAAATCGGTGCTTACT
ATTATGCAAGGAGTTGGCGCCATTTTAACGGGGACCTTATCAGTTTGTTTTCTTGCAGCGACAACCGATTTTTTCTTGCAGTGGCAACCGCTCCGTTCTT
GGTACTGGCGGTTGATTTGCTTAACTTAGAGTTAGGCTGCGAGATATGATCACCGGGAAGGATTTGCTCGTTGGTTTAGAGCCCTTAATCGCATGCCAAA
GTTCGTGCAAAGCACAATACCTCTTT