Description :
From Genome Similarity Track
Location :
Scaffold_65:239607- 241814
Transcript NameFunction/comments
Hyaar_Emoy2807559HECT ubiquitin ligase, putative

Sequence
2207 bases(100 bases per row)
ATCTCAAAACTAACGCAGCCCGACTGCAAATGCTTGCAATTGTAGGGGTCCCTTCCACGATCATGATATTGTAGACACATGACCATTCGTAGTCAGAATG
ACGCCTAGCGACATCCAATTGGGGTCATGCTGTTGTGAACCCCGTAAGGTCGGTGTCCAATGCAGCGTACAACATGCTCTTCAGCTCTTTCTTGTTGTGA
TACAGCGGCAAATCCAAACGGTTGAAGCACGCATGACTGGATATGTACTGAGTCATTTGGTACGACACGCCCTTGAGATTGAAAGGGCATAATCGGCCAT
CGTAGCTGGTGAGGCCACGGAATCCAGACAGAGGCACGCATGCTGACCCTGTTGCAAACAGCAAAAGGCGCCGACGGTATTCATTAGGCATTTGACGAAC
AATCTCCCAAAACCAACGGGTCAGGCTAGCGTTCTCGAGGTTCGGAGTCAGAACAGTATGAGCCTCCCAATCCGTGACATCAATTTCGGGAGATCCACAG
AGGAGATAGTCAAACTCTTCTGGGTCAAAGAGAAGCAACATGTCGCGAGGAATGACTTCGTACAGACCTGATAAGAACGCGTACATCTGATCTGCCACGC
TCTCAAACAGCGCGTACCGGAAGCGACGGTCCAAATAGTCACGCTTGTTTGCATCGGTGACGACCAAATTACGGCCGTTTGGGACCAGGTCCACCACCAC
CTTCTCCGATCCATTTACCACCTCGATGAGACTAAAATCGAGCTCGAGATCTTCCACACCGTCGTTATCCATTATCCACCGCAGACTGCGGTACGTTTCT
GGGTCGAGAAACTCCATGTCAGCGAAAGTCACTGGCACGCCCAATATCACCTTCAGCAACGGAAGTGCGAGGTGGAATCCCCAAATTCCACCCTCCAGTA
GTGCCCGGCCAATCAACCGTCCGGTGGCAAAGTAGCAAGCAAGGTGATCCTCACCAACATCGGCGCGGGACTGTGGATTGAAATAGTAGCTCTGATCGGC
CTTGTTCGTGCAAGTAAAAAGCCGCAGTGTCGGCGAAACCAGCAGCTCATTTACCAGCATGAACCATTCGCGATGCACACCTCCAGCATCCACGCCACTC
TCGTCCAAGAAGTTGATGCGCATGAACGAGCGCAAATTTCTCGGCTGGATACAAACCATGTGGTCCAGAGACTCCTCGAGCATGTAGTCACGGTGCACTG
ACAACTTCAGAAACTCCACTTCGGCAGGCACAATGAGTGACGCCGTGCTAACGACGAAATGCGCGTATTTGGACGGAAAGTCACTCGCTGCTAAAGCCAC
AATCTCTTTCCGTCGCTCCGGACCCGCATCGACAAGCGTCGACTTGCCAGTCGAGAATTCCGTGGGTTCGGAAGCTGAGGCCTCGGTAAGTTCCGTCTTG
ACACCTGTAAGCAGCGCGAGCTTTTCAAAAAACTTATCTCTCATCTCCTGCAATGTCTCCCCCGTCTCTACTGCTTCAGTTACCACATCCATAATCACTA
GATCCTCGTCATCTTCCTGCTGCCATCGCTCCACCTCCTCTTCATCATCGTTTGCTTCACCCGCATGCTTTTCTTCCACTTTCAAGTCCCTGTGCTCTGG
AATCTTGAACGACAAAGTGTATCCAGGCATGAGCGCGTTCACCTCAGTACTCACTGGCAAGTCACCCCCTCCACTGCGATACCAAAAGAGGTTTCCTTCC
ACATCGAGTTTCCGGCTCCACTCTCGACGGTTCCTCGCCCGACGTTGCTGTCGAGTCAACGACGACAGTTTCCTCGACCGGGGCGATAGTAAATGACCTA
TCGTGCCTCGATTTGCTGGTGACGAAGTGATCAAGGATTCTCGCCGTTCCTGGTTCGTATCGAAAGGATACGGACTCCGGTCACAGTCATCTGTACTCCC
GTCTTCATCCGTGGTGATTGACAAAGACAGGAGTTTATCACCACAGAGCACGCAGTACTCAAAGCGCTTGAAGTTCTCGAAATCGCAACTTGCACAGACA
CTGAACCCAGCTTCGGCTTCTCGAGTAGCCGCGTCGATTCGGTGGTCGACTGACTCCCCCGAGAGCAGCGGAATTTCCATGTCAATCAAGTGGCGATTCC
GACGACAAGCAAAGAGCCAAACGATGAGGAAGATGACGCACAGAAGCAGCATCCCAACCACCTGGTACATCATGGAAGTCGGTGACGAGTGTTCCTGGCC
GTCCATG