Description :
From Genome Similarity Track
Location :
Scaffold_3:23960- 24972
Sequence
1012 bases(100 bases per row)
GTGCCGTTGGCTGGTAGGAGCACGAGAATGGTCTTGAGCCGCACATCCTTGCGTATAATATTGTGAACGGACACCAGGGTCAGAGATCGCTAGAGAGCAC
TGCGCACGGCATCCGAAAAGTGGCAGAGTCACCAAATAAACCCCGCGCTATCAATGAACTTTCATGAAGCGGTCGTAAAATTGGCAAACTGGACGTATAA
CTCATCCTTAATGTTGTAGGCAACACTTCTTAATGGGCTTTTGCAATTATTTTCGCCCTATAATACTTAATACGAATTTATAATGTTGATGATAAAACAT
GCTAGACATGTTAAAGGTGCACGATGGCCTATGCTAGGATGTGTGCAGAATATTCTGGAGGCTTCTATTTGTATTAATAGGTTTTATATAGATATTGGTT
TGAATAGTTATCACTTTAAGATAAACACGCAACTGAAGAGGGCGCAGGCGGAGTCGATGTGCGTCTTGCACCACGCTAATAAACAAGTTAAAGATTTCGC
TCTACTTTACCAATTAAATAGGACCGAACTAGCTTGGCGTGTACGTTATGCTTTACGTATTTAACGACAAAAAAGAAGTAGATACTGACAATTCGGCTGT
GACCTTATGCCCTTACTAATAGTACCATAGGATGATAAATAATAGTTTCTCCAATAAAGTAGTTATAGGACTCAAAAATTTTCGTTCGTCTCTATAAAAA
ACCCGCTCACAGTCTATGATTAAAATGCCAATAGAAAGCTATTGGTAGTGTCATATTGACTACTGGCGTGCTTGATAAGGTGCAAATTGTAGCGTAAAAA
AGCTAAACCATGCGATTAGCGGCGGTTTTTCAAAATTTTCTTGATATCAATTTTAGGTTATGGAGATAGGACGTAAGTAAGGCATACAATCTAAAATTCA
TTAGTTTCTCTTTTACTAGACATTAATCCCTTTTGAACAGAAGCTGACCACCACCCCTGTTGCTTGGAGTTTGAGATAAAATAAGGAAAATTTAATTACA
CAATAAGTTGTA