Description :
From Genome Similarity Track
Location :
Scaffold_1157:2396- 6082
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1157-snap-gene-0.2Formin-homology 2 domain-containing protein

Sequence
3686 bases(100 bases per row)
GTTCGGGCGCGAGACCGAGTGCGGCGTGTGCACCAGGTCGTTCAACCTGCTGCGCCGGCGCCACCACTGCCGCGGCTGCAACGTCGCCGTGTGCAAGGAG
TGCGGCCGCAAGGCGATCGACCACCGCAAGGGCGAGCGCTCCAAGCCGCAGTGGTACTGCGACCTCTGCATCGAGAGCGACGACGCGATCGAAGTCACGG
GCTCGCGCCCGACGCTCCACAAGCGCATGAGCTTCTCGGCGCCTTCTTACTCGCCCTCCATGCCACCTGTCACCAGCGTACGTTGCCTTTTATTCTTGTT
AATGAACTGCTCATTGCTTCATTGGTTCTCATTATGCTCTTCTGCGTGCATGGGTACAGCTCGCGAGTCATGCAAAATTCTGCGTCGAGTGCGGATACGA
GTTGCCGCATCGCGTCAAGTTCTGCATCGAGTGCGGCACATCCGTGCGGCCACAGCTACTGTCGCCTGTTGGAGGTGCTGAAAGTGGACACGAGACAACG
AATCGGCTGTCGAGAGCGACTTCACGTGTCTCGATTGGCAACAACCTCATGGTACGTGAATGAGTGCTCGTATTGTGAAGGATTTTGACGGTGTCACTCT
TCTAACCGTCGTATATGCCGGCCTCGCTCATTCATTTTGCGGATAACAGATCATTGATGAGCACAGTGACACTCCGACAGAGCCGATGGACGGGTCCGAA
GAAGAGTCGACGATGCCACTCGATCACAAGGAAGAGGACGAAGAGGGGTCCTCGCAGTCGCAGGAGAACAGCTACGTGGAGAACGGCCACAGCGACGAGT
CTGACGAAGCTCTGGCGCAACTGCGAGCTGAGAACGACAAACTGCGTCAGCGCATTGAGAAAATGAAGCGCAAGGTGACCGAGTCGGAGCGAAAGCGACA
GGAGCAGGAAGAACAGCACCGGCGCGCTCTCGCTACAGCAGCGCAAGCAGCTGCACAAGTACAAGCGGCCCCAGCTGCGTCGATTTCTGCTCAAGACGCG
TCTGCTGCCGCGCCACCGTCCGCAGCAGCAAGTGGAGCCGGCGTGAAGGCGAAAGAGCACCCGGACTATATCAAATTTTTCAAGCTGCTTTCGATGGGTC
TTCCTCCTGAGCAGGTGAAGATGAAGATGCAACAAGCTGGTGTGGATCCAGCAGTCCTTGACGATCCAGAAGCGATTATTGGCGGCACAGGCGGTGTAGA
GCAGAGTGGCGCTCCGGCCGGCGGTTCGTTTGTGAAGGACGATGAGAGATACGCCAAATTTTTCAAGCTTTCAAAAATGGGGATGCCAGCGGATCAGATC
AAGCTCAAGATGAGCGCCGAAGGACTGGACCCAGCTCTGCTAGACACCCCAGATGCGCCGATGCCCGGTTCTCAGGGTGCTGGTGCGGCAGCGCCACAGC
AAGCCATGACCGTGAAGGACGACCCGGACTACGAGAAGTTCTTCAAGCTGATCAAAATGGGGATGCCGCCAGCGCAAGTGAAGATGAAAATGAGTGCATC
TGGACTGAACGCTGATCTCCTGGACACGCCCGACGCTCCGTCTCCAAACCAGAAAGCAGGAGGAGGAAAAGCAGGCGGTGGCATGCTGGCTGGACTGCCG
CCTCCGACTGAAGCAGTGAAAGTCGACCCGTCAGCGTTGAAGGCGAGTCTTGCAACGAAAATGCAGAGGGCTTCGTCGTCGAAGAAACCAGAGGAGCCTC
AACTCCCAAAGAAAAACCCTGTGAAGCCAAACGTAGAGCTCCGTCCGCTCTTCTGGACTCGTGTACCGGTCAACGTCGTGAGCAGCACGCTGTGGATGAA
GCTGGATGATGCGAATGGCACGTTTGACGTCGACGAGATGGAGTGGATGTTCCGCAAGAACCCGGTCGACAACAAGAAGTCGGATGACCAGAAGAAAAAG
GATGCCGCGAAAGAAGCCGCACAGCCGCAGACAGTCTTACTGCTCGACCCGAAGCGACAGCAAAACGTTTCGATTGCGATCGCGCGCTTTCGGATGTCAG
CCACGGACATCAAGAGTGCGATTTACTCGCTGGATGGATCAAAACTCACATCTGAGATTCTGAACGTGCTCATCTCGATCTCTCCAACGCTCGAGGAGCA
AGATCTGCTGAAGAATTACGATGGAGAGGAGAAGCTGCTTGGAAATGTCGAGAAGTTCTTCCTTGAGCTGCTCACGATCCCGCGATACACACAGCGCATC
AAGTGCTTCCGCTACAAACTCCAGTTCGAAAATCGTATCCTGGAGACTCAGGCACAGTTGGACACGCTCGTGGCAGCGACAGACCAAGTGAGCGAGAGCG
ACAAGTTTCGTCGCGTGCTGGAGAATGTGCTGGCGATCGGAAACTACTTGAATGGCAGCACGCCGCGTGGTGGAGCGTACGGATTCAAGCTGGACACGCT
CATCAAGCTCCACACGCTCCGATCCGTGGACCCGCGGATCACTTTGATGCACTTTCTTCTGCGTCAACTGGAAGAAAAGTCACCAGAGGTGATCGCAGTG
GCAGGCGAGCTGCCGCACATTGGAGAGGCCAAGCGGTTGTCTCTGGACCAGCTTCGCTCGGATCTGTCGTCGTACAACACTGAGCTGGCGATGCTGCAAG
GTCAGGTGCGCGCTTCAAAGAGCGACAAGATTGAGGGCGACAAGTTCTACGAGCAGATGGCACCGTTTTCCAAGGATGCAGCTGAAGTTCTGGAAGAGCT
TGGGCGCGACTTTAATGCGCTGGAGACATCGTACCATGAGCTCGTGAGCTCGTTCGGAGAAGATGCGCGGAAAGTGGGGCCGATGGAGTTCTTCTCGATT
CTGGAGGAGTTTGTGACGGAGTTCAAGAAAGCGTACCGCCAGAACCAGACGAAGGAGTACCAGACCATCTACGAGACCGCTCGAGAAGCTCGTGAAGAAG
CGATCCGTGTGGCGGAAGAAGAGAAGGCTGCGCAGCTGAAGAAAGAGGCGGAAGAGAGGCATGCAGAGAACACGAAGACAATATATAACCAGGTGATCTC
GGTTCTCACCGCATGGGCGCAGTCGCATAAGAACGCCAACGTGAGCGAGGTCGTCGAGCAGTTTAAGGCCACGTCGCGCAGCTTTGGCGTGGACGAGATC
TCGGCGGACGAATTCTGCGAGCAAGTTCGGAAACTGGTCGGATCGAAAACTGCAGTCAAGATTATCCCTGACAGCGCAAAGCTACTCTTTGATCCGTCAA
AGCGAGAAGATTTGCTGGCAGCGTTTGAGCGGTTCGTGGAGCAGGTGAAAAAGGAGAAGGAGACCAAGAAGCGGTCTTCACTGACATCACCCCCAGTCGC
CCCCGCAGCAGCCTCGCTGGAGCGACCACGCACGGTGTCTTCCGGGAGACGACGCAACAAAGTGGCGCTGATCAAAGTGGAAGACATTGAGCCAGTGGTC
GGCGAGGCCGCCAGTCAGCTGCACAAGTCGATTCTCGAGTCGGTCCAGATCGCGTTTAACGGCGACTCGAAGAGGATGAAGGTGTTCACGTCGAATGCGC
GCAAGTACGGCAGCGAGCAGATCACCGCGCGGGAGTTCTACCAATATTTAACGGCGTCCTTCGAGCCCGACTTTGTCGGACGTCTTGTGCCCGACCTGGC
GCGGCTGCTGCAGGACTCGGAGAAGCGCCACGCGTTGATCCGCGCGCTCTGTGAGAGTGCCCCCGGCTGGGAAAAATTCTCTGGAC