Description :
From Genome Similarity Track
Location :
Scaffold_15:239578- 244403
Transcript NameFunction/comments
g3136.t1XP_009517071.1 hypothetical protein PHYSODRAFT_261139 [Phytophthora sojae
g3137.t1RAW30103.1 hypothetical protein PC110_g13545 [Phytophthora cactorum
g3138.t1POM59712.1 hypothetical protein PHPALM_31514 [Phytophthora palmivora var. palmivora

Sequence
4825 bases(100 bases per row)
CGAAACCCTCGAGCTCCTGACTCTTCCGGCGAGCGCACTCGATCACTGACGAAGGAAACCCCGCCATTGAAGCCACGTGAACACCAAAACTCTCCATGCA
AGGCCCGTCGCGCACCTGGTACACCATCGTGATCTCCTTGTCGCTGGCCACGGCGGTAACGTGCTTGTTGGCGAAGCCTTGCGGGTGCTCTTGGTGCAGC
GCTGTCAGCTCGTGGAAGTGTGTCGCAAAGAGGCACATCGAGCGCGCCTTGGTGAGCAGGTACTCTGAGATGGCCCAGGCCAGTCCGAAGCCATCGTACG
TGGACGTACCTCGGCCCAATTCATCGATAATCACCAGCGAGTGCTCCGTAGCCTTGTGTAGAATAGCCGAAGCCTCCAGCATTTCCAGCATGAACGTAGA
AACACCGCGTTGTTGAAGATCGCCCGCACCAACGCGCACCAACAGCTTGTCGAACACAGGCAGCCTCGCGACTTCTGCAGGCACAAAACTACCGATTTGT
GCCATCACAGCAATAGTGCCCAACTGACGGATGTAGGTACTCTTACCGCCCATATTAGGCCCGGTCACAAGCTGGAAGCGCGATTTCTCGCGCTCAAAGT
TGTAGTCGTTTGGAATGAAATCGACTCCATCCTGCAGCTCCACACAAGGGTGGCGCGCACCTGTCAATATGACGCAGTCTCCATTTTTCTCCATAGTAGG
GCGACAATAGCCTGAGCCAGCATGGCATGCCGCGTGGGCGAATCCAAGCAGCACATCCAATTCTGCCAGTGTTGCAGTCGCAGCCTCGAGCACAGGTACG
TATGTGCTAGCCACATCAATAGCCGCGTTCAGCAAGTGCGCTTGCCGCTCCTCGTATTCGCCGCGCACACGGCGGTACTCGGATGCCAGGCCCTTTAGCG
TCGTTGTAGTGAATTGGACTCCGCTCACGAGGACTTGGCATATATGCACCTGTGGCATCTTGGACAACCGTGCCTCCTCCTTCTTGTTGGTAACACGGAA
CGCGAATCCGCGCACCTTGTCCTTCTCGCACTTGATCTCACCACCAATCGTATCGAGTGCATTGCGGTGTTCCTCCTCAATGTCCGCAAGGATGCCATCC
CACTCCTCACGCAGCGCCTGGAGGTCCTTGTCATGCTTTGCGTTCACCACAAGGGTCGGACGGCTGTCCAGATCGACAACCTCCTTCACAAGCTCCGTGT
AGCCTTGCAGATCCGCAAGCTCCTTCTCCAGTGGAGCGGCAAACTTCTCCTTCACAAGAGCGGCCAAGGCCGTATCTCCACCCGCCTCCGTGTTTTTCAG
CAGCTTCAGCACGCGCGGCATGGCGCCGACAGCAGCATCGTACACACTAACGAGGTCCGTGATCTTGGCATTTTTCTTGCGTTCAAGGCTGACCGCCAGT
CGCCCCAAGTCCGGCAGAGCCTTCATGCACTCGTCCAGCAGCTCCATCCTCAACGACGAGTCGTCCACAAAGAGCTGCACGAGGCTCTGTCTCGTCTCGA
TCTGCTCGACATCCAGCAGCGGCTGTCGGATCCAGCGTTCCAGCAGACGGCGTCCCATGGGCGTCTTGCCACGGTTCAGGATCTCCAGCACGCTGCCTCC
GAACCTCACCCCCGTGGTGGTAGCGCTGGGCTCCGGCAACAAGTTGAGCGACCAGACGGCAGCGCTGTCAAGCTGCATGGCTGACGCCAAGTTGCCCTGG
CTCAGTGTGTAGCAGCCAAAGGTATCGGCGTCAGCCATGACGCCCAGCGCCTCGATCAAACAGGCCAGTGAGCCCGCCGCCAGCTTAGACGAGAGCACGT
CCTGGTACTCGGCCATGGTACCGGCTCCCAGCAACCTGGAGACGTTGGTCTCGAGGCCGTTGGCGTCGCTGAAGAGCTGCTTCTTCCTGTACACTGCGGC
CACGTCGTGGGTCTGCAGCAGCGCGTGCAGCTTCTTGCTGTCGCCCACGCTCTGCGTCTGCTCCAGCTCCGCCGACAGGAAGCACGTGGAAGGCGCCAGC
TGCAACAACAGCGACTCGAGGTTGGCCAGCGCGCTCGAGTCGGAGAAGGAGAAGAGCACGAGCTCCCACTGCTTCCTGTCCTCGCCCGCCTGGCCCTTGA
CGCATGACGCGCGGGCGCGCGGCCGCCGCACCGCCACGCCCACATGCTTCAGGTGCTTGTCGTTGCGGATTTGCAGTGCCACCTCGGCCTGCGCTTCGTC
CAGCAGCACCACGGACGAGTCGTCATCTTCGCGGTCGGCCATGGTCTCCTTTCGGACAATTCAAGAGTGAAGGTCGGTTCAATAGGCGCTTCCCGCGCTT
TTCTCTGTCCGGGTTGAAGTGTCGCAATGTGACTTCTTCAAGAGAGAATGGGTCTTTTGACCTCGGACACTTTCGACTTGCTCAGAATGGCGACGGATTG
GCGTGCGGAGTACGTGAAGGCGGCGGCGCTGGGGGACGCAGGAGACGCTACTGGGGACGTTACAGCGGTGCAACAGACGGAAAAGACGCCGGTGGGCGGT
GTGCTGGCGTTTCTGGACCTCCTGCTGACGCAGGAAGGCGGCGAGTGGTGGACCAAGCTGCAGAGGAAGGCCAGGCGAACGGCTGCCAAAAGTGATGGTC
AAACAGTGGACTCAAAGGACCAGAAGCAGCTGACGGCGCTCAAGACACGGCTTGCAGCAGTGGGGACGACACTCGTGCTGCAACTGCCGCATCTGAACGC
GTCTCTGAGCAAGGAAACGGCCAGAGTGCGCGTGCTGCAGCTGCAGCTTGTGTGCCGTATGCTGTGCTATGCAGTGCTGATCAAGAAGAAGGAGAGGAAA
CTGCTGAAGAAAGAGATTCAAGGATTAATGGACCGGGTGGCTCTGCTGCTGGATGCGGCGAACCCGCCGTCGCTGGCGGATGAAGACGCGGATGAACGCT
CGCCGTTCCAGGAGTTCCTGAAGCAGCAGTTGGCTCCCAGACTCGAGCTGCTGTTGCCAGAGTTGATGCAATATTTGCTGAAGGCATACGAGATGGAAGT
GGAGGAGAACAAGGCCGACGAAGATGCGAAGGACTCCAACTTGCTCTTACCGACCGTGAGTGCTGGTGTTATCTCCCTGGTAGAGCTTTGTATGTGACGC
TGATCACTGATGTTTGTGGCTTGTGTGCAGTTGCTACCGGTGGTGAAGCCTCCTCAGTCACCTGCAGAGCTACCGACTTCTGTTGCTAGTGGCAATGGTA
GTATTCTGTCTGCGTTACGCCAAGAACGGCCAGCAAAGCGTGCTCGCCCCGAGGCTAGCGAGTTATTCAAGGAAGTCACGCTCCCGCATCAGTTGCAGCG
GAGGCAGAAGCAATCTCACCCTCGGAAGTCGAGACGGGTGACCAATAGCCACAGTAGCGGCGCAAGTAAGAGCAGCCAGGACTCACTGCTGCGTGCGGCG
GCTGGTACTACATCACTGCACGCACCAAGAAAGCTGGAATTTGCGGGCAAAACAGCTTTGTACGGCGCAGCTTCAAGTGCTAGACAACCTGGCCAATCGA
ACTTGCTGCGTCGTGCCGCTAATCCGTCCGCGCCGAAGGGGCCTGCCGCGCCCTTGCTCCAACGAGCAATGTCGGAGCGCTCTCACTTCCATGGCCGCCA
AACGCCAATAGGTTCATCGCCAGGTTCTGCTGCACAAGATGCCGGAGTCGCTACAGCTGGCAAAAAACAATCTCCTGGATCTGCATTACGGCGCTCGCAA
ACCACTTCATCGGTAGTCATGCGAACTCCAGACAGACCGAAAAGAATGGCAGCACGAACCACGAGGCGCGTGCTCGTCGAAGCATCTCCTCCACTGCGCA
GGCCCACCGCAGCCGCTGTGCCTCGTCTTCTTCAGCCCAAGTCGTCTCGGCCAGGTTCCAACCCACCTCCTCTTTTCCGGTGACGGTGGCACGCGACCCG
AATAATAGACAACGAAGACTTTTAAGTTCATCGGCATTGCCTAGCCATTACTATCTCGTGTGACTGTTGTTGTCATCGCTGTCGCTGTCGCTGCCATATC
CCACCAGTCCCAGCGCCGCCGTATTCGGCTTCTCCTTCTTGGCAACAGGTGATGTGCTGGTGTCTTTTGGCTCGACCTTCTGCTTCTTATTGTCCGGTTG
TTCCTTGGTGGCATCACAACTCTCGGCAGCCTTCGTGCCAGCCTTACACGGCTTATCCTTCCCAGCCTTTCGCTTGGCCCGCACCACCACGACCGGGGTC
TTCTTGCCTGCCACCTTCACATCGTCTTTCACCGGATACTTTTGCAGGTGCTGCGCTGTAAGTCCCGTCCCAGCGGCGGTCTTAGGCGCACCGCGTGCCA
CCACTACACGCACCAAACACAACTCGTCGATCAACACCAACATTAAAGCCACCAATAAACCCTTCTGCCTTACGGAATTGCGCCAGGTCTTCTTCATGTT
GCGTCTGGCGCCTCCGTTGAACGTCGTCCTTCTTACTCTCCAAGTCCCGAATGTACTCGAACTCTTCCTCATCCAAACCCTTCGGGGGAGCTGTGCAGCC
ATAAAAAACGAGTTCGAATTAATTACCGCAGCAACCACAGCCACAGATGCCACGCACCGAAGGGATTGTTCTTCTCCTTCCAGTCGCTGTCCTTCTGGTC
TTTGCGCTCTTGTAGCTGCTCGTACAGCGGCTTGTAACCTGCCGCGTCCTCTGCTCGAGGCGCGGGCGCCTCCGTCACGCGCTTCTCCTCCACATTGTCA
CCGAAGAGCTGCAAACATGAGCCGTTAAAGGAACCGCAATGCGTGACCAAATCACTAGACGATACAGGGACACACCCCATCAGATGACGTGAGCACGGAA
GTGGACACAAAGCCCGCCAGAGACG