Description :
From Genome Similarity Track
Location :
Scaffold_2:239567- 242729
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G001088Similar to SPAC1A6.10: Uncharacterized protein C1A6.10 (Schizosaccharomyces pombe)
Pytul_DAOMBR144PYU1_G001087Similar to pho2: 4-nitrophenylphosphatase (Schizosaccharomyces pombe)

Sequence
3162 bases(100 bases per row)
ATGGTCAAGACGCAGGGCTTCGCGTCGCTCGTGGCCGCGTTCGGCATCGGCGCCGCCGCCGCCATCGCCGCGCAGTTGGCGTATGCTGCGATCACGAAGA
AGAGAGTGGCGGACAAGTCCGCCCGGAGCGGCGCCATCAAGCGCATGGTTGCAGACAACAAGGCGCAGGAAGGCGGCTCCCGCCCCGTCGGCTCGGACGC
CATGGAGGACGCGCTCCAGAAGGAGCAGCTCTCGCGCATCCACACGTTCTTTGGCGAAGAGGGCTTTGAGAAGATCAAGAACGCGTTCGTGATCGTCGTG
GGCGTCGGCGGCGTGGGTTCGCATGCTGCGCACATGCTCGCGCGCTCGGGCGTTGGCAAGTTGCGTCTCATTGACTTTGACAATGTGACACTGTCGTCCC
TCAATCGCCACGCAGTCGCGACGCGCGCCGATGTCGGCACGCCGAAGGTCACAGCGATGAAGAAGCACTTGCACGAGATCGTACCGCAGTGTGAGATCGA
AGACCTCGCAGTGATGTTTGAAGAAGCGTGCGCCGACGAGCTCTTGGAAGGCAACCCGACGTACGTGCTTGACTGCATTGACGACGTCAACACGAAGCTC
GCGCTTTTGGTGGCCGTGTCGCAAAAGAACCTCAAGGTGATTACTGCAACTGGCGCTGGCGCCAAGGCAGATCCAACGCGGTTGCAGATCGGCTCTCTCT
CGGATGCCGTTCGCGATCCATTGGCGACCAAGATGCGCTACTTTTTGAAAAAGAAGAAAGTGTCGACGACCAGCATCACAACGGTGTTCTCGAGTGAGAA
GAGCGTGTGCAAGTTGCTGCCGCTCGATGAGGAGCAGGCGCAGAATCCGAGCGATTTTGGCAACGTCGAGAACTTCCGCATCCGCGTGATCCCCGTGCTG
GGCACGATGCCAGCGCTTTTTGGTCAGACCATGGCGGCGTACGTCCTCTGCGACCTTGCGAACCAGCCGTTCGTCCCAGAAGCAGTGGCGCGGCTCTCGC
GCGACCAGCGCAACAAGCTCTACCAGAAACTGCTCGACCGCGAGCGCGTGTTGGGCATTGAACATGGCAAAATGGAGCTCGAGAAGGATGAGATCGAGTT
CATCTTCCAGGAAGTGTGGCGCGGCCGCAGCTCCGTGAGCGGTGTGCGTCAGGGCGGCCACCAGCGCATGTTCATGGCACGCTGGCGCGCGGATGTGCCC
TTGCGCCCCGACAACGTCGTGTTCCTCACGACGAAGGAGCTGAACCAGTTCGACAAGGACGGCGGCATTCACGCGTTCGGCGACGAAGTGCTCGCGAAGA
TCGACGCGCGGCTCCAGCAGTTCGGCGACTGGGACCTAGACGCCAAGTAAATGAAATTAGACATAGCGTTGAGGGTTGCATGATGCATCATACAGATTTT
ACACAGTAACCAATACACAAGGGTTTGCATCCTCTATGACGCTCTGCGACATGTGTCGCTCATCTGGCTACTGACACAATCTCTCTCAAATACTAATTCT
CATATGCTCACCGTTTTACCTACTAAAAAACTCGGACTGTGTCAGTATCCAGAGACAGTTGCTGCGTTGTGGGGAGGGGAGTGCGTCATTTGGAGCTTTG
CGCTGTGATCCGCCAAGCAGAACGCAATAAGACAAGCGAGAGAGACGCGATGGCGCAGCGACTGATCCCCAAGAAGCTCGAGGGCGGCGACTGGAAGCAC
TGGATCAGCAATCTCGACGCCTTCCTCTTCGACTGCGATGGAGGTTCGTATGGCTACTGTCTCTATGGGTAGGTAGCAATGCCAGAGGGGGAACTGACTA
GACTGCTGTACGTGTGCATGGCTTTAGTATTGTGGCGCGGCAATGCGCCGATCCCCGGCGCTGGTGAGCTCGTGGGGCTCTTGCGCTCGCTCGGCAAGCG
CGTCGTGTTTGTGGTACGTGCTTGCGCTTGGTCATGCAAATCGTGGTCTTGATGGAGAAGGGACTAAAGGGTGGATGAATGACTGAATAGACGAACAACT
CGACTACGAGCCGAGCCAACTACGTCAAGAAGCTGGGTATGTGTTGGCTCCTAAACGTTGCCGTAATATGCATAATGGGAGTGTGCTAAGCGGGATTTCG
TGACGCTATGTGTGTGCATGTACACTGTTTCCCTTCCGTAGCCAAGCAAGGCATTCCTGCGGAAGTGGATGAAATCGTGACGTGAGTGCGGTCGTTTTGT
CGCCAAAGTCTGCGTAATTTGCACGTATATTGATGATTATGGCAATGCATGCGCCATAACAGGTCTGCGTGGGCGACGGCCAAGTACATGACGAACGAGA
AGATCTCGGGCAAGGTGTACTACATCGGAGAAGCGGGTCTTGGCGAAGAGCTCGCGAACGAGGGCTTCGAGCCCTTCGGTCTTGAGCATGGCGACGTCAA
GGAGCTGCACACGCCGTTCACCGTCGACAACAACGTCAAGGCGGTCGTCGTCGGTCTCGACAGAAACATCTCGTACTACAAGCTCGCGTACGCGACGGTG
TGCATCCGCAACATCCCAGGCTGCCGGTTCATCGGCACGAACCCGTACGTTACCCCAATGCGATGATAAATATTGCGTCAATGAAGTAACGCTAGCTGTG
GTGCATTGCTGTTCGCAGTGACCCAACGTTCCCAGTCGACGGTGCGATTCTGCCAGGTGGCGGCACTCTCGTCAAGACCATCGAGTCTGCAGTTGGACAG
TAAGAAGAGTTCCCTACTGCTGCGCATTTTCTTTGGTGTATCGGCTAATCGACTGACTGAGGTATTGTCTCTTTCTTCTCTGTGTAGCCCTCCTGAGGCG
GTGGTCGGCAAGCCATCGCAGGACTTGCTAAAGACCATCCTCACCACCTACGGTCTCGACTCCTCCCGAACGTGCATGGTGCGCTTTAAGCAACAGTTTC
TTTTGAACAACTCGTACCAGGCGAATACTAACGTGTGACACTATTTTTTGCTTCTGCAGGTCGGCGATCGTCTCTCCACGGATATTGCGTTTGGTCGCCT
TGGTGGTCTGCAGACGCTGCTCGTGCTGACGGGTGTCACACACGAGTCGGAATTGGCCAACATCGAGCTGCCAGAGTTCACGCCGCACCACTACATCCAG
TCGGTCGACGTGCTCAACCAGCTCCACCGCCAGCAGCAGAACTAAGTAAACTGCAGTAGCCC