Description :
From Genome Similarity Track
Location :
Scaffold_42:23953- 26185
Transcript NameFunction/comments
Phyke_g2232hypothetical protein PHYSODRAFT_558741
Phyke_g2233hypothetical protein PHYSODRAFT_543712

Sequence
2232 bases(100 bases per row)
ATGTCGATTCACATGCGTTCGCAGCTCTGTACGTGTTCACATCTCTCACTTCTCTCTCCCCCCTACCTTTTAACCCCCCCCCCTTCCTGCAGTCCTAGTG
CGTCCCCAAACGCTCAAATTCGGATCGCGCGCCATGGACATGGCTAAGAAGTTGCCCCAGCGCAGTCAGGCGTTGGCTCTGCGTTTGCCAGCTCGTTCAG
TGACTCGCACACCACAGATCGTGGTGGCTGGCGCTGTGTTGAGCGCCTCTGTGTCTCTACTGCTCAAAGAGTCGGCCTTGTGCCAAGAAGTGTTGCTGGC
CGCAGCGGTGAGTGGCTGATTTGCAGCGTGCTACAATACGAAACCCCATTGACTCTGTCGCTGACTCtgtgttgctattgctgcaaTTCAGGAGGGACCG
TCGGGAAGTGACgaccccaagaagaagaagagcaccGATCCAGTGGAGCAGATCATCGACACTGTGCTGGCCAACTGCGGCGAACTTACGCTGGCTGGAG
GCCTGGGCTTCTGCTCGGGATATGCAGCCAAACAAGTGGGCAAGGCTGCGGCACTAGCTGTgggcttcattttcatcatgGCGCAGGCAGCGGCTTACAA
CGGTTACATTGACATTAAGTGGGGCAAGGTGCAGAAAGACGTGATTGCCAAGGTGGACCCGAACGGAGACGGCAAGATCAACAGCGAGGACGTCAAGCTC
TGGTACCGCAAGTTTCTCAAGATTATGAAGACCAACCTGCCATCGTCTGCTGGCTTCTCCAGCGGCTTTGCGCTGGCCATCTACTACGCGTAATTGCTTG
TTGCAAAACGTTGGTGACCCCTTGTGGCATACATGTATATTTGAGACACAGTAGCTTGTGGTGGATGGCATCATTAACAATAGACATCACTTTGCTACAT
TTATGTGGTTCTGCTGAAAGACGCTTATCTATCGAGTACAGGATATTCTGTCACTGTGCATCTAGCTGGCCTGTTTCGACAGTTATTCGCATGGGAAGGC
CTTGGCAAGGAAGCCCACGATCACGGACCGATCGTCTGCACTGCTGACACCCATGCTCTTGAGCTCACGCGAGAACGCTGGTACGCTGCTGATCCCGTTG
CTGATGAGATTGAGCCCCAACGTGGCGTATAAAATGATCTCTGGTCGGTTGAACGATAAAAACGTCTGCTTGGCACTCTCGGAGCACGTTGGGAAGCAAT
CCTGCCACATCTTCTCACGTAACCGTGACTTCTGGTCATTATCTGCCACCTGCTTGTACATTTAAGTGGAGTAATATACCCACAACGTAAGACACTCACC
ACTCACAATTCCGCTCCAGCAAAAGTGTCGCTTTAGTTTCTAAAGAGAGTTATGAACGTACCGACACGGGAATGGCCGGTGACCTCTCTGCTCCGTCTGG
CTCCATCTTAATTCAATCAGCGCGCAATACAAACAAACACCACTTGAttagcaacagcagaaatCCCATTGCACATGGCTTGTcgagagggggggggggg
gcagaCCCTACCGACAAGCCAACCTTACGGAGCCCTTGGGTACGGAGAGTGATTCCTCGAGAAGACAACTGCGTCGCCTACAGCAAGGACATCAACCAGC
CAAGCAACGAGCACAGCCCCAGAGTGGGTATCGTCCTGCAGGTTTCACCCTCTCTCGTCCACGTCCTAGCAAAACCATCCAACTATCTCTCAAGCTAAAC
AAAGAGTGCATCGTACCCCTGGGTCCTTCTCGATGTAGATCCGGTACGCCTCCGTCGTGCGAAGGCGCGGCGTGTACAGCTTTGTCTTCCATTCCTGCAT
ACATTTAGTTTAATGAGCCATCGTTTTTAAAGTTAGTAAAAACAATTAACTGCTGGAGCGGATGCAATCACATTCACAGTCTCACTTACCTCcgtctcgt
cctcgtcgtaGTCGAACTCAATGGGAGCAATCCACCCTCTCTCCAGCAGCCTTGCTAATATATGGCCAGCCATTCTAGTTCGAGCCTCCCCCACCAGCGT
CGTTGCTGTGACAGTGGctgtcggagctgcagacgcgctgccttccaccaccagctcaaCGTCTCTCTGCTCGCGCTTGGCTGTCGTCATCTGCGTGGTG
AAGAGCTCCACTCCGTCCCGCTCCAGCCACTCACGCAGCACTGTCTCTTCCATAAACTCCATATCATTCTCGTCCGACGTCTCCAGGATGCCAGCGtgct
ccagcaacaccacgAACTCGTCTTCACTCATG