Description :
From Genome Similarity Track
Location :
Scaffold_1122:2395- 6816
Transcript NameFunction/comments
g10079.t1XP_002896061.1 conserved hypothetical protein [Phytophthora infestans T30-4
g10080.t1XP_009518077.1 hypothetical protein PHYSODRAFT_295452 [Phytophthora sojae

Sequence
4421 bases(100 bases per row)
CGCTTAGGCCCCCAGCGGCTCGGCCTCGACCTCTTCCTCGCTCTTGACGTCGCCCTTGGCCGCGAGCTGGGACGGCTCGTGGTCGTCGCACTGCGCGACC
CACTTGCTCTTGACCGGCATGATGTGGCAGTTGATGCGCATGACCTTCAGCCCCTTCGTGACCTCCAGGTCCACCTGCGTCCAGTTGTTGCGCTGGTCGG
GCATGGTGCAGATGTGGCCCACTTGGGCTGGCCGCAGCGGCCGCACTTGTACAGCTTCCGGTTCGCGTCGTCGAGAGCCATCTTCTTGCTGGCCGATGAG
GAGGCAGAGGTGCTCACACTGCGACGCGGCGGCGAGCGGCCCGGATTGAGGTCTGCGGGACTCGGCTCCTCCGGAACCGAGAGGAAGCCTAGATTCATCT
GGGACATATCCACCGATAGCCCCGACGAGCGGTTCGGACCGCGCCTGCGAGCGGCTGCGCGGGGCGGCAAGTTGCTTCCTAACGACGAGCGTCGGCCGTG
CAGCGAGTGCACCGCCCCGCTGGCAATCTGAGGCGGCACCTGGAACTGGAACTGCTGCATGTTGGGCTGTGGTGGCGCCGGGAACATGGTCGGGTCCTGG
AAGCTGGCGAACGGGTTGGGGTACCCTTGGTTCGGGTTCATGTTCTGCTGCTGAGCCGACTGCATCTGTTGCTCCTTGGTTTGCTGCGCCAAAATGCGGA
ACTGGTCCAGATTGTGAAGCAGGTCCACAGGGTTCGAGTGGTGCCTCGAGTGGTGGTTCACGGGGCGCTTCCGCTTCATCTTGAGCTCATTTACTCCCTC
TTGGATGCGCTGCGAGCGGTAGGCGACGGGGGACGCGCCCCCATTAGTTCCGCCATTGTCGTCCGTCGTCGCTGCGTTCACCACCGGTACCTGTTGCTGC
TGCTGGTCGGGGTTTAGCTCCGACCACGATAGTTCCTTGAGGAACTCATCCATTTCTTGGAACGACTCTCCCTGAGGCGTCGCGGAACCCGTGAACGGCA
TGGGGTTGGTGATCGGGGATTCCCCATGGACAGGTGCAAAAGGCATCATGTGTTGTTGCTGGGGAAAGCCCATACCGTTGGGCCCCATGACAGGCGTGGA
GATGACGCTGGGAGCCATGTTGGCCATGCCGAAGGCCTGCAGCACGTCCGGATTGGAACGCACGCGCTTGTGTTTGTGCTGCGGCGCCACGCGGTAGTTG
GCCCCCACGGCCGTCGAACCGTTCGGGTTGAAGGAGAAGGAGAGTGGCGTGAGCAGGTCGTCGCTCTCGGCCTTGGGCGCCATCATGTTGGTGGGCGATG
AGCCGGGCACGTCGCTGTCCAGCAGCATTTGGTCGTCGGGCGCCACGAAGCCGGCGGGCGCGTTCACAGAGCCGTCAGCGGGCGCGTCTCCTCCCTCGAG
GAAGTTGTAGTCGAGCGGCAAGCCGTCGAACAGGTCCAGCGTCTGCGCGTCTGCCATGGGGACCGGTTGGGAGAATTCTGCTATAGAGGTCGAAGCTCTT
GTGAGTTCGGTGCGTGCAAATCGAGTTTGGAAGGGACTGGTGCGACAAATTCATGCAGCCTCGGATTGGTCAAAACTCTCTAAACCCTAGCCCTAATCTA
CCAGCTGCCGCCTTGATTCAAAATGGCTACATTATGCAAGCGGCGGCGTCGCAACCGCACTGCAACGGCTTGACGTGTTTGCACGCATCACGTTTGCCGC
TCAAGACGCTGTTAACAAACACTTTCTTAATACTTTCTTCATACATATTATCCACGTGGGGAGGACGCGCGGTTACCCCTCGCTACAGGCTACAGAGTGT
GCGGGAACGCCATGGTCGGCGTGCCGCCGCCGAAGCTCGAGACGCCCATCTCGTACGTCACGGTCTCCGCCGGATGGTGCTCCACCGTCTGATAAAAGGT
TGGGTCCAACGCGCCAGCCCGTGCAGGATCTTGCAACAACGCCTGCAACAACGCACGCGATCGGCCGAACGCAGTCAGCAACCAATTTTCAAGCCCAGAT
CGCCCTCAAGCCGGCGCCGCGCCAACGAAGCGATGCCATCCGTGTCAACTCCAGCAACAAACGTTCGACGCGGCGGCGGCCTTCTTAGAAAAGAAATTCA
CTCACCTGCAGACTCAGCGGGCTCAGCTGCGACGGATCCTGTCGCGGGTACGGGTCCCACATGCCCGCGCCGTTTGCGCCAGGCTGCTGAGACTGCTGGC
CTTGCTGATGCTGCTGCTGTTGCTGCTGGTTGTCGCCTATCCGGGACATAGCGTCAATCTCACCGTTCGCGGCGGGGACGGCGGCCGGGAGCCAGGCCTC
GCTCCCATTCTGCTGCTGGTCGGTCTGATGAACAGGAGACGCGCTTTGGCTTCCAGTGGACGTTTGGCGCTCGTAGTATCGTGGGTCATAACCATTGTTG
GTCGCGTACTCCTGACCCTCATACTGCTGGGGTGGGGCGTAAGGCTGCTGAGCGTAGGCAGCGGCGGCATACAAATTCGGGTCGCCGCTTGGAGAATGGC
CCATTAGCATGCCTCGGTTCTGTTGGTACGGCTCCGCCTTCAGGTCCTCCGTGAGCATGGCGACGTGGCTAATGTGTTGGCCCTGCTGCATCTGCGCCTG
CTGCTGCAAGAGTTTCTCGTGGAGACGCATTTGCTGCATTTGTTGTTGCTGATCAAGCTGCTGCACTGCTTCGGCGTTATGCGCTTGCAAGTGCTGCTGC
TGCTGCAGAAGTTGCATCTGTCGCTGCCGCATCAACGCCGAGTTGTTGTATCCTATGGCCGCCTGTTGTGCCGCCGCAGCTTGCGCTTGCTGTTGGTTCT
TCTTATGCTGTGCGTGTGAAGCCGCAGCCTTGCTCGGGTTCTGCTTCAGCGACTTCCACCGGATCTTCACCGAGTCCTCCGTACGACCCTTCAGAAGCTG
AGAAATCTGCGACCACTTGTTGCCGAGCCGTGCTTGGGCGGTGAGGATCACCGAATCCTCCTCTTCAGTGTAAGGGCCCTTATTAATGGCTGGATCCAGG
TGGTTCTTCCATCGTTCACGGCACTGCTTGGGCGTACGTCCTGGGATACGCTCAGCGATCTGGCCCCAGTTGTTGCAGCCTTGGGTCACCAGATACTCGA
GCACTTGGTCCTCTTCGAACGACCAGTGCCCCTTCACCAAGCCCGGCTTTAGCACCTTGCGCCAACGCTGAAGGCACTGAGCGTGATTGCGCCCAGGGAC
CAGCTCAGCAATAGCCTTCCAGTTCTTTTCGCCGTGGATACGCACGCTCTCACGGAGAGCCGAGTCTTGACCCTTCGTCCAGCGCTTGGTCGTCGGAGCA
TCCGGGTCTTCCCCCAGCTCAGTGTTTCCATTTGAGTTTTCTGCGTTCTCTTCATTAGCTGCCACCGGCGTTCCTGCATCGGAGCGGGTGCGCTGCGTGG
GCTTCTGCTCGCCTTGGACAAGCGTGCGGCTACTCTGCGGACGGTCACGCTTTGCTGCAGACACGTCGTCGTCCTGTGTCGAGAATGTCGCACTGTTGTC
TCCCGGGATAAAGCCCTTCTTGTTGATTTCCAACTCGCGCAGGTTCAACTCCGAGTCTGCAATGTGCGAGTTGCTCAGCAGACGTCCCACCTGCGAGATA
TCTTCCTTGGAGATCACCACCGATGACGAGGACAACGAGCGTCCAACGACAACACCGTCGGCGTTGGGCATGCCCGCTAGGTGCTGGGCCGTTAGCTTAT
GCCCATCAGCCTCTTTGCTGGAAATTGCACAAAACGTAGAGCAGTTAGCGCAATTAACACAGACAATAGTTGCACTAGGATGTCGTACCCATCGGGGCCC
ACCACGGCATTGAACGAGTGGAACTTGTTGGCGCCGCCGTTGAGCATCTTGACGCGGCTGGCAGCTGCAGAGAGAGAGCAAAACGTTAGCATCAAAATCA
TGGAAAGAAAAATGATCTGGCTGAGCGCACCGTTGAGTGCCTGCTTGCGCTTGAGGTGCGACTCCATGTTGTGCTCCTCCTGGGCCTGCACCTCGGCCAG
CTTGGCCTGCTGCACGAGGAACTTTTTGCGTAGATTCAGGATGAACTTCTTCTTGCCCTCGACGGTAGACTCGGCCATGGCTTTGATCACGCGGAACTGC
TTCTCGTCCCGCAGGCGGCCCACGTAGCGGCACAACTCGCCACTCTCGCTCGGGGACAACCCGCTGAGCGACATGAGGAAAAGCCGCGAGGCCTCGGCAG
GCAGCGACTGCAGCAGCTGCGCCAACAAGTCTCCAAAGTTGTCGGTCGCCGCCGATTCCGTGGGCGGCGCCGGCTCCGGCTGGTTGTCGATGGCCGTGTC
CGCCATGCTTGGGCCGTGTGCGTGTCGTAGAGAAGAGGGGCGGGTGCGCGCGCGGGCGAATATTGCCTTTTGTCTGCCAGCGGTCGTTCTCCCCCTTGTC
GCTGCGGTTTCCCCTTCCCCT