Description :
From Genome Similarity Track
Location :
Scaffold_3103:2395- 3633
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_3103-fgenesh-gene-0.0Pleckstriny domain-containing protein

Sequence
1238 bases(100 bases per row)
CAGCTTGGCATCCTGGGAGACGCAGCTCTGCGCCTGGTCTTTCCAGGATCGGAAGCCAATAGGCGACTTGGACGTCGGCGAGCTCTCCGCCTCTGCAACA
CACGCAGTAGCAAGCAACGAATGCAGTTAGACCTTTACGACTTGCTCGTGAACGCTATGGCACCAGCACATTTACCTTTGGCGGAGCGCGTGGTGTGCTC
CACCTGAAGCTCAAGCGGACAGAGTTTCTGCATGGCCGCGGCGTGTGAAGCTGCGCGGTCTTCTCGGAAGAGGGCGAATGCGAAAGTGAGCGCTGCCTCT
CTGGGAAAATGACTTGAGAGTCATCAGCATGCTATTGTGGGGGTGTTGGCTGGGCATGAGCTCGCGCGCTCTAGATATAGCTTGTGAAATCTGGTGGCAT
CCCAGCTCAGCTGTGCGACCCACTCTCCTGGCTCATGAGCTCCATTCGCTCTCATCATGCGCAGCAGATAGTGACGCACTTCTTATCAGACATACAAGCA
CGTGAGCAGCTCGCACAGTTAAAAATAAATGGCTACATGTTCTCTGTGCGCATTTCGCATGTCGCAGAGGTTGCGATTGATTGTCACAGCATTGCGATTG
ATTGTCACAGGAAACAATCAATCAATCACCTGATTGCAGTTTCTTGGTTTCGAAACGAAACCAAGAAAAGCAAGTCGAATAAACANNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGT
TTATTTATTAACTGACTGACCCGCAAGAAAAAATGCTTTTTACGAAATGCTTATTGGCAAACACTTTTGGAGGGGTCGCCTTGTTGCATATCCGCTATTT
GGGGGGATTTTCGTAGAAAAAGTCTTTTAAAGGACCTGCACCGCTAGTATACAAATTTCAAGTCAAAGAGTCCTGTGTTTTTATTCTGAAACGGCGGCTA
CTCTTTTGGATATAAAAAGGATTGGCGCGTAACCCATACAAAGCTCAAGATAAAAGTCCTATAGTTTTTATATCCCGTTTAACCAGAGCTTATTTTTGGA
CACCAAGGAAGTGCATGTTCGAACACTTCAAAAGTGCT