Description :
From Genome Similarity Track
Location :
Scaffold_1174:2394- 4149
Sequence
1755 bases(100 bases per row)
TTGGGGATGGCAATGCTGCGCCGGCCCCGGCCAGGGGTGTGGTATGTGACCTGGATGTGGGTGACGCCAAACCCGTTGCTCAACGACCAAGGTCCATTGC
CCCTCACTTGATGATGAAGGTGTACGAGCTCCTGAATAAGCTGCTGGAAACGGGTCGAATCGAGATGTCGCTGTCGCCGTGGGCTTCCCCGATTGTGATC
GTCCTCAAGAAGAATGGCGTGGACATCCGAATGTGCATCGACTACCGGGTGGTTAATGGGTTCATCCGGCGTTTTAGCTACCCGTTGCCCCTGATCGATG
ATCTCCTGATTGGATTCGAAGCCGTTATGTGGTTCATGAGTCTGGACATGGCGAGCGGGTTCTGGGCGGTCCGGATGACGGAACGTGCGAAGCTAATCTC
CGCGTTCATCTGCCCATTCGGACACTTCCAGTGGGTACGCATGCCATTTGGACTCAAGAATGCCCCACTCGTGTATCAGGCGGTGATCAACAACTGCCTT
TGGGGTTTCGTGCGTCTCCCTCGGGAAGAAGAAGAACAGGTGGACCCGGATGTACTCGAGTTCCTCGGTTTGGACCCATCCGTCCGGGATGAATCCGAAC
GGGAGAAGGCTGGAGCTAGTGTTCCCGTCTTGGTGGAGCAGATGACTGTGTTTCAACGCAATATCCCGATGCCGTCCTAGATGGGACCTGTCCTCGGACG
GAGTTCCAACATCGATGACATTGCGCATGGGGCGCCCACCTGGGATCAGTTGTGTGAGGGCCTGAATGCACTGCTATTCCGGTTGCGCTATTGGAAAATC
TCTGTCAGCCTGCCCAAGAGTGAGTTCGGGAGTATCCCGTATCTCCCTACGAGATCAGTGCCGAAGGACTGCGCGCGACTCCGAAGATTGCGAAGGGTGT
TCAGGATCTGCCGTTCCCGTCTACCCTGAAGGGAGTTCAGTCATTCCTCGGAAGCCTTAACTACTATCACAAGTTCATTGAGGACTTCCCGATTGTGGCT
GCAGTCCTGTTTGAGCTCACGGAGGATCAAGTGCAGTCCGGCCGGGACCTGTCCTGGGCGAAGGAGGCATTCGAGATCTTGAAACGGAAGATCGTGTCGA
CACCCCTGTTGCGACACCCCGACCGGACCAAGCCATTCGTGATTATCCCGCATGCTAACCGCTGGGCCGCCTGCGCGGTACTCGGCCAGGAATATGGAGT
GATCCAGCCTGTGAGGTTCACGGGGCGCGTACTGAACGACGCGGAGATTCGATACCACATCGCCGAGAAGGAGGCAGTTGCTGTCATGCGAGTTCTGGAT
GTGTTTAACACTCTCGTCCAGGGTTGCCCGATCAAGGTGCACACCAGGTATTCAGTACTGTCCTGGCTGTTGAAGTCCAAGACCTCCGACGGCCGACATG
TCCGGTGGGGGTTAACACTATCCCATTGGGACTTGGAAGTGCAGAAGGTGAAGCAAGACGAAGACGGCCTGGCCGCGATCCTGGGCGCTGGCATAACGCC
GCGTGAGCACCTGGACGAGGTTGCTGAGTCGCTCATCCCGGCCAAGGGTCAAGTGAAACCCCCACCGGTGATCAGTGTGGAGATGCTGGAGGCTAATTTC
GCTGGATACGTCTTGAGTTTCGACGGAGCTGCGAAGACATCGACGAGGCGAGGAAATTGTGGGTGTATCATCTGGGAGCTCCCCGACTGGAAAGTCCTGG
CCGCGCGGGGTTTCATCCTGGATGATGTTACGGTGAATGACGCTGAGTACCTCGG