Description :
From Genome Similarity Track
Location :
Scaffold_3:2393806- 2396515
Sequence
2709 bases(100 bases per row)
TTCAAGATGCATTCCAAGATCATCCTGTTGCTCGGTGTTTGTGTCGCTGCCTCCATACTGCAGACGGCTGACGTGCGCACTACCGGGCGCCACCCTCGTA
AGCACGATCATGGGCATAGGCAGCACCACGGCCACGACCACCACAAAGACCATTCGCACTATAGTCGCCGCTTAGAAGACAAGGACAACAAGGACGACAA
GGTCACGGAGTCATCCAAGTACACCAGTAGCTACGGCAAATACGATTATGGCTGCGACGACTATGGCCACGACGACTATGTCACGACGACCATTGTCACG
ATGACTATTGTCCTGATGGCTACCAACGGAAGGGCCACGGCTACCACGAACATGAATACCAGGGCTAATGGCGTTTGCTACAGCTACCGCTACCAGAGCT
AATGGCAAGGACTACGAATGACTACAACGACGACTACTAACGGGCACGGCAAAAACCTACTACAGCTAATGAACAAGGGGATAACGGCAAGAAGGGACTA
ACGACTACTACCCTGACTACTACTCGTCGTACAGCGGTGGCTATGGTTTATGATGGCTACTATAACAACGGATACTATCCCGATTCCTACTCGTCCTATG
GCCTACGATGACAAAAATGACTATGGATACTACCCTGATTACTACTCGTCCTATGGCTACCCTAGCTATGGTTACGGCTACGATCACGGCAACAGCTACG
GCTATGGCAACCCCTCCTACGGTTTCGGATCCCCGGGATTCTTCGACTACGAGTCTGCTGCATCGGACGCTGGCACGGACAGCACTCCGAAGGAGCAGGG
CTCGGACGCGGCCAAGAGTAAGTCGGAGAAGAAGGAAGACAAGCCCAACGTTGAGAAGAAGGAAAACAAGTCGAATGCCGCGAACAAGTCGAAGGGCAAA
TAAAGACGTGATCAGAGAAACATGAAGCGTGTGCAATACGTAGCGTTGGAAAGCAGAGGTAACACTAGAAAATACAATGCCAATTAATGTGACGTGGTAA
ATGGTTTGAGTTTAGTTCGGACTCGTCCGTACAAATGGATTAAGTATTGCGTTCGGTTGAGGAACCGCGGACTCCTGTAAGATTTAATGACGTCTTTTTT
TTATCCAAGTATCCAAATCCGAAGGTTCAAACTCCCGCTTATGATGAGCGTTGGATATCATTTTTAGTACTGTAAACAACAACTGTGAGTCACAAAGTTA
TGATAGAATGAAGTTGCGAGAATCGTGTTGAATGCCTCAGTCTAAGTAGTCATGACAGAGAAGACCTCTTTGAGGTGACGGCGATAGATCCGAAGCGTTG
TGCTCTCTCCTCAGCGTGTTGCCGCTCTCTCACTTTTCCTTTCGCCTTCTTTTTTGCACTCTTGACCACCGCCCTACCAGCACCACCGTCAAACAACCAA
GAAACATCGCGTTCAAGATGCATTCCAAGATCATCCTGTTGCTCGGTGTTTGTGTCGCTGCCTCCATACTGCAGACGGCTGACGTGCGCACTACCGGGCG
CCACCCTCGTAAGCACGATCATGGGCATAGGCAGCACCACGGCCACGACCACCACAAAGACCATTCGCACTATAGTCGCCGCTTAGAAGACAAGGACAAC
AAGGACGACAAGGTCACGGAGTCATCCAAGTACACCAGTAGCTACGGCAAATACGATTATGGCTGCGACGACTATGGCCACGACGACTATGGTCACGACG
ACTATGGTCACGATGACTATGGTCATGATGACTACAAACGGAAGGGCCACGGCTACGACGACCATGACTACAAGGGCTATGGCGTTGGCTACAGCTACAG
CTACAAGAGCTATGGCAAGGACTACGATGACTACAACGACGACTACTACGGCCACGGCAAAAACTACTACAGCTATGACAAGGGATACGGCAAGAAGGAC
TACGACTACTACCCTGACTACTACTCGTCGTACAGCGGTGGCTATGGTTATGATGGCTACTATAACAACGGATACTATCCCGATTCCCTACTCGTCCCAT
GGCTACGGTGACAAAAATGGCTATGGATACTACCCGGATTACTACTCGTCCTATGGCTACCCTAGCTATGGTTACGGCTACGATCACGGCAACAGCTACG
GCTATGGCAACCCCTCCTACGGTTTCGGATCCCCGGGATTCTTCGACTACGAGTCTGCTGCATCGGACGCTGGCACGGACAGCACTCCGAAGGAGCAGGG
CTCGGACGCGGCCAAGAGTAAGTCGGAGAAGAAGGAAGACAAGCCCAACGTTGAGAAGAAGGAAAACAAGTCGAATGCCGCGAACAAGTCGAAGGGCAAA
TAAAGACGTGATCAGAGAAACATGAAGCGTGTGCAATACGTAGCGTTGGAAAGCAGAGGTAACAGTAGAAAATACAGTGCCAATTAATGTGACGTGGTAA
ATGGTTTGAGTTTAGTTCGGACTCGTCCGTACAAATGGATTAAGTATTGCGTTCGGTTGAGGAACCGCGGACTCCTGTAAGATTTAATGACGTCTTTTTT
TTATCCAAGTATCCAAATCCGAAGGTTCAAACTCCCGCTTATGATGAGCGTTGGATATCATTTTTAGTACTGTAAACAACAACTGTGAGTCACAAAGTTA
TGATAGAATGAAGTTGCGAGAATCGTGTTGAATGCCTCAGTCTAAGTAGTCATGACAGAGAAGACCTCTTTGAGGTGACGGCGATAGATCCGAAGCGTTG
TGCTCTCTC