Description :
From Genome Similarity Track
Location :
Scaffold_168:23937- 27450
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_168-snap-gene-0.20Myotrophin
Pytir_DAOMBR486snap_masked-pir_contig_168-abinit-gene-0.35Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_168-fgenesh-gene-0.12Conserved gene of unknown function

Sequence
3513 bases(100 bases per row)
GAGATGCTCGCGGAGGCGGCTGACGGGTTCTTCCTCGCAGCGGAGCACGGCCGTTCAGACGTGCTCAAAGCACTCGCAGACCACGCGCAGGGCCAGCTGG
ACCTGCGGCAGATCGTCGACCCCGCGACGGGCCGCTCGCCGCTGCACGTGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTACGCGTGC
TGCTCGCCGCGGGCTTTCCCCCCGACCACGAGAGTTTCCCGTCGGCAACGGCAACCAGTGGCGGTACTAATGCTACTACTGCTGCTACAGATAGTGGTGC
TGGGCCAAAGGCATCGGTAGAGGACAGCTTCAGGAAGCGCCAGAACACTGCGTACCTGCTCGCGAAGCAGCTGCGCGCAACCGACCTCGTGTTCGTGTTT
CACCAGTTCACGATCCAGCAGATCGCGACCAACAACGTGGACGGTGTGCGGCAGATGCTGAGCGCGGGCGTAGACGCTGACACGACCGACGGCTCGGCGC
AGAACACGTTCCTGCACTGGGCGGTGACCTGCTCGGCGAGCCAAGTGCTGGAGCTCCTGCTCCAGAGCGGAGACGTGCAACGCGTAAAAGTAATGGACCG
AACGAACGCGGAGGGCGCGACACCGCTGCACCTCGCGTGCCGAGCGAACAACGTCGAGTGCGTGCGACTGTTGCTGCGGTACCACGCGGACCGCGCGATC
GAAGGCGGAAAGGGAGTTTTCAAAGGCAAGACCGCAATTGAACTGGCGACGGCACAGGAGGTGAAGGATCTCTTTACAGTTCATGCACAGCAGCATATCG
GCGAGTTAAGTGGACTGCCATGCTCCTCCTCCTCACCTTTATCTTCATCGTCTGCGTCTTCTCCGCCGTCTTCTGGATCCACAGTCGCCGAGTCTGTCTG
TGAAGATGATTCAAAGTCAAGGGTCACATCGCGACGCAACTCTCGACGCCCCTCGGAGCAGGAGCTGCAAGGCGCCAAGCTGTTGGTGCAGCTGGAAGAG
AAGGACCTTTTGATTGTCCAACTGAGAAAGACAATCGAGACGCTTGTCATCGAGTCCCAGGAGATCCGGAAGCTCGGTGACGAGCGCGTTGTTCTCGACT
ACGTGCGCAAACTGCGTGAGGTGGGTCTTGGGAGACGTGGAAGTGAATTGGACATGTTAAGGACATTGGCTCTAACATTGTTGCTGGGTCTGTTGTTGTG
TTGACTGGTATGTATTATACAGGAAAATGCGATTCTGCAGCGCAACCTCGAAGACGCCGAGGAGCACATCCGGATACAGCAGGAGCAGCTGCAGCAGCTC
AAGTCCGAGATGCGGAAGATGGTGACGGTCGCGCAGGTATAGGACGAGCTCATTTCATATGTCGACCAACTCGTGTGATCTTTAGATCATATTTAACTGT
TGTATCTGTGGTTGAATTGGCTCAGGTATCTGCAAGTGAAAGCGACGGAGCAGTCGACAATCGTCATCATCACCACCACTCGACTGAAGCGTCAACAGTC
CAGTCCACCAATTTCGGAAGTCCATCAAGAGATCGGAACTCAGTAGCAGCTGACCCCTCCGGTCACTCAGCAAACCCGCTGCGTCTCCACACCTCTGGTG
AGCGCGCCAAGCACAACTGGACAGAGAAAACTCCGCCTAGTTTGTCCTCTGGCGGCTCAAGTGACGCGTGGGGGAAGAGCGTCCTGGGCGGACTCTGGCC
GTTTGGCAGCAGCGACGACGTGCAAGAGATTGACGGTGAAGTTATTATGACGGTGTAGACAACGTGGCAATGTGGTGAAGAGTTCGCTTGGAAGAAAGAA
GGAAGGTATTTTTTGTATGACAATATCGCAATGAATGAGCTGGTGCGTGACCGACCCCTAGTCGTTCGTGGTTCATCAGCAGGCAGGAGACGAGAAAGAG
GCGACAATGCCCCCCTTCCTGGCCCCAGAGATTTGCTGCTGCTGTTGCTGCTGTTTACACACGCTCGTGAGTAGTTTCTCTCGCTGCTTCGGGTCGTTGT
AAAGCGCGCAGTTGTTTGCGCACGGCCGCTCGTATAACGGGGACGACCCCATGTTGCGAGCACACGAGCAGAGTGCGGGCGTTCGTAACTCGGTCGCTAG
CGCGCTCAAGAAGCGCTCGTGGGTCTGGTTGTCGTCCTTCCGAGCACTTGATGACGACGATGAAGATGAAGGGCCGCTTTTCTTCCTGTTGGTGGCGAGC
GATGGTGAAACCAAGTCAGTGTTTACTTGAGCTTTCATGGCTTGTGACGAACTCACCTCCATGGAGTCGACGATGACGCCACTTGCTTGTGCAGCCGAAC
CTCGCAGCCCAGGGTCATGTCGACACTACCCAGAATCGAGAAAGAGAGCAACATTTCAGAAGGCTGTCATGCCAACATCAAGAGCAATGCAAATACGATA
TCGCAGCACGTACACTTTCACGCCGCAGCCTGACTGGCGTCTGGGCTCGTTTATTGTCTCTCTGGCCCTTGCTGTTGTTTTCGTTGAGACCACTCGAGGT
TGCTGAGACTTCTGCGGCTGGCGGCTCTTGGCGTGGTCCTTCTGTGCAGGAATAGTGGAATTCGCCACTGGGGTTTGGGTATTCGAGTTAATGCGATGGA
TGTCGGCGCGCTCTCGCTCCATGTACCGCCGGCGGACTGTGACGTACAACGCGACACGCTAGATGTGCGTGGACAAAGTTGAGAGTTTAGCTCACAACTG
GTACTCCTGCGATGCTAAAAGCCAGATTTCAAGAGAGAACTCAACAGCCAAAGTGCCAACCTGCTTTAGGAGAAGCTCGTGCGCCGAGTTCCTGGGTTTG
CGCTCTTCGTCGTCGTCAGGATCATTCTCAAGACTCCAGGAGTCTGGTGCTGAAGCTGAATCCTGCTTCGAAAATGAGTGGTGATGGTTCTTTGGAGAGA
GACTCACTGACGCGAGCATGAGCTGCCGGGTCTGGGCATCCAGTCGCAGGACCTACAAGAGCGGATACAGGCCATTCACTGTTGAGCCAAACAGCACTCT
CACAAACATGAGCGAAAACTCACAAAGACGCTACCTTTTGAATTTGGGCAGACAGAGCGCTGCCCTACGTTGAAGAGAAAAGCACATGTGACAAAGTCAA
TCACTATCCAACCATTTTCGCTTCGTTTGGTGCTGAATCACGAACGAACCTTGAGCGAGTCGTTCTTTTGCTTGGCGAGGGCCTCGATATTTGCCGCGCG
CACGGGACTCGCAGACCGCCACGTCTCCTTGGGTTTCGTCGCCTCGAGCACTTTGATGAACTTGTCGTCCTAGCAATTCCAACAACAAATAGATAGGTGC
ATTCATGAGTCCAAGTTCCCAAGAAGACCACTCGAGAGCCGTCTCCTGTTACCCACACACCAGAAGCTTCTCCTGCTGTTGAGCCTCCACACGGCTCTGC
TGCTGCTTTTCGCTGATGCGGAGGCAGATCTGGTCGTGGAACCGTCGCAGCTGCTGCTTCTTGGAGAGCAGGCGCTGCTCGCTCTCACGGCGCTTGGCGT
CCGTCTCGGCCTG