Description :
From Genome Similarity Track
Location :
Scaffold_1:2393503- 2396272
Transcript NameFunction/comments
g731.t1hypothetical protein

Sequence
2769 bases(100 bases per row)
GAACCCATGCTCGATCACGTCAGCAGACTCGGGGTGCCGGAACTCGACATCGGCACCAAGACGCGGAGCCAGCTGTTCGGCCGCGTCAACTTCTTCGGGG
AGCTCTCGCTCGACCACCCGCGGGAATCCATGCTCGACCGCAAGTGGGAGGCCACGCTCAACCACATCATCGCTCGGACGTGGGAACCCATGCTCGACCA
CGTCATCTTCTTCTTCGGGGGAGAGCCACTGCTCATCCGGACGTGGGAAACCATGCTCGACCACGTCATCATCGTCTTCATCCGAGAACCACTGCTCATC
GGGACGTGGGAACCCATGCTCGACCACATCGGACGCGTCCTGAGACTCCTGCTCAGGACCGGCGCAGGTTGCGTTTTCGCATACTGCACATGAAGGGCCA
TCGCTCGCTTCGGGTGCAGCATGGGCCATGGATTCGGGGTCCATGACTGTAACATGCGGCCATTGGTTTGGCGTTCCGCACAGGAACGCTTCGACGGCAT
TCACGTCGATATCGCGGGGGCGGACTGTACCAGCGAGCCAATCGATGGCAGGCTGGTGGCGAGCGAGCCACGGGATTCCGAAGACGCAGTCGAAGGAGCC
ACTCAGCTCGATCACCAAGAACTCCTCCGAGCCGCGGAACCCGTCAAACTCGTACGCGAAGGTGGCAGATCGCCGTGGCGTACGCCGCGGCTTCCCGTCA
GCATACTTTACGATCATCTCACCGCCGCTCTCGCGGATGCTCATGTCCGCCGGCAATGCCGACAAACTCGCGGCGCGAACGAAGTTGTTCGTCGCGCCGG
AATCCAGCAGGGCGCGTATTGGGCGCTGTGCACCTTCAACGTGGAGACTGAGTACGATCAGTCTCGAGTCGCTGCCAGATGTGGTGGCTGATAGGCGTGC
GTGAAGCACGGGAGGGCTAGGAGGAGGTTCTGCCACCAGAGAACCATCGCTCCGTACACACCCAGTAGGGCGCCCCGCACCTACTGGTCGTCGCCGTTTT
TTGGAGCGGCGACGTCGTTCGCAGTCGTAGCGTTCGCCGCCATGGGCGACGGAGCACGACACACCGCCGCGCGATGGCCAGGTTTGCCACATCGAAAACA
CTTCATACGACGCGACCCCCGAGTGGAGGATTGGCGTGAAGGCGACGTCGGCTCCCGACGTCCGCGATAGGACTGAATAGCATCCACCTCCATGGGTTCG
GGCTCTGGGTCGGCCGTGAGACATCGAAAGCTTGCGATGCCGACACACTATAGTCTTCACGCAAAGCGACAGTGAAGGCTTCCTCCAGCGTCGATGGCGT
CTTGCGGGTCAAGTAGAAGCGCTGGTAGCCAGCATTCATACCGGAGACAAAGACGTGGACTTGTGTGGCCATGTCGACTGGCTGCGTCGTGATACACGAG
GCGAGATGGCGCGCGCGTTGAATGTACTCGAGCATGGTCAGACGTCCCTGCTTTAGCGAAAGGAATGCCGACCGTTGAACGCTTTCATCTTGGGGCGGCT
CGAACGCGAGTCGCAGGTCAGCCTGCATAGCTGCCATCGTCGGGAAGCAGGAGGCGTCGGCCACGAGTCGGCCGAGCGCCCACTCCTTCGCCTTCCCGGA
CAACTTGGAAAGCAGGAAGCGCGTGCGCGCGAGCTCGGTAGACAATTGCCGAGCTTCGATCGCTATGTCCACCTCGCAGAACCAGCGGTTCAGGTGAAGG
CGGGTCTTGCCTTCGCCGCTGTATGTGGAGACATCGAGCTTGACGATGTCGGTCTTGTTCTTGGACGGCGTGGGAGTCGTCGCACACCGACGTAGATCAG
CGAGCTCACGCATTAAGAACTCTTGAGCACATAAGCGTTGTTCGTGTTCCGTTCCAGTCGTCAGGAGCGTCTTGACGACCGTGTCGCCTGACACCGCTGC
CAGGCGGTGGAGTGCTTCCCACTCCATCAGCGTCAGGTGCGGGAAGTTCTCGTGCTCCAACGACATACTCGAGATGTCGTTCATCTTGATCTTGGGCGTT
GAACGGACGACGAAGTGCTACCAGGTGTAACGGGCTAACAGAACCCGTTACCGACGTACACTGTAGTTGCGAGGAAGTAGGTAAAATGAACTCTGATTGA
TTGATGTGGACATGCAGTAGTCGAGACTCGAGACCGTCCCAACCAACGGTTGTACGCTCGACTCTGATTGGCCACCGCGCACACGCGGTGGCACCCGTAT
GACAGAGGCCTGTCACATCTGGCACTGGCTTCAGCATTGGCCCCAATGTCGCCTGCAGACCAGTTCACGAAACTGGGAGGTGTCGATGTACATTCCTCGT
GCAGCCCGATATTCGATAGCTTCAAGAAGCTCTTCGTTGATATAGATCAATTGAGGCCCTGGACGATACGTAATAGAGAGCAATCCGGCAACGCGCATTC
CAAGCGACCCTCGAGCCACCTGAAGAGCTCAGAAGTGTAGGTTACTGAGTGATGTAACTTTGTAGAATGAAAAGCTTCGAGTCGAGTGAGGGGTTACATA
CGTGCGGAGCCCAGGGCTTTACAGCCACCAAATCTAGTGTAGGATAAACGAGTTCCGTGCCTCTGGCAAACTTCTGGCTGCGGTGCTTGCTTTGACTTAA
TAATTTGGGGTTGTATGCCGCACGAAAACCATAGTCACGTCCTGATCATAGTTATGCCTAGCGCGGATACCTACCGCCTCCGCTAAAACCGTTCATTCTG
AAGTGGGTTTAGTAGCGTTTCTATAGTAGCGCCTTCGTACTGATATTGGTAGTGCTACTACTATCGAAA