Description :
From Genome Similarity Track
Location :
Scaffold_53:239345- 246397
Transcript NameFunction/comments
Hyaar_Emoy2806659unnamed protein product
Hyaar_Emoy2806660hypothetical protein
Hyaar_Emoy2806661endomembrane protein 70-like protein, putative

Sequence
7052 bases(100 bases per row)
TGCGCATCGGTGTTACACGTTCTCTCTACGTCTCTTGGCTTCAGCTCCTACTCGATTGAGCTTCTTGCTCTCCGTCTTCTTCTGGCCGCGATACTTATGC
TTATCCCAGCGCGACATTTTTAAGGAATCGCGACACCCAGCACCACCTTCCCAATGGCAAGAGGTTGACTTCTTACTAGCCACGTCATTGCCGCACGAAC
ACACCTTGACGGAGCTCGATTGTTCTTTCGAACACAAGCCGCAAATCATGCGACTTGCGAATTTTCCCAGGTTGGCCTCCGGACAGTTACTTGAGTCGTG
GCAAACGTCACACGGGAACGCTTTTCCACAGCATTGGAATCGAAACCAGCGCTGCGAGTACTTGTAATGGTCACACGTTCCATTACGAGGTAACGGCTGT
CCCAGCACAAACACTTCTGCGGGTTGCCTCGGTCCTTTCGTTCCCTTCGCGATCTTTGGAGTAGCGTCATTATTCTGCTGCATTGATGTACTCTTTACCG
GCGCTGCAATAAAGCGTTTAGCCATTACAGCAAGTTTGACGTGGCAGGAGAAACAGACTTGCTCTGATCGCTGTCGCGGCCTTACTCTCGCCAGTAACGT
CTCGCATCCACACTCCAAGCATGTGGCTAGCACATCGCTGGGGAGAACGTCGACAATACTGCAGTTCTCCGTGTCCGCGTACGCGAGCACGTCGCTCTGC
GAGTGCGCAAATACTGGCCGCATAGACACGTGATGAAGTACACTGCACCGTGGACACCACTTCTGAAGTTCTGCGGCATCCAGTCTGAGAGATGCATCGA
ACTTCAAGGGGCAGTTACCACATTGAATCTGGCACACCAGGTCATGCACGACGAGAGTGCCAACTTCGTGCAAGAATAAATCTTCGAAGCAAATACGCGT
GCCCTTTACTTCAGGTTCGGTCGAGATTGGCAAGCGTTTCTCAGCTGGAACGATCTTCGAGTTGTGGACATATTTCTCGTTTTCACTTGACTCTGCTGTT
CTTTCACCGGTATCCATCTTTTCAGCAGTAGCAACGGGGTCCACGCCACGACGAACGAGTTCGCACAATGCCTTGAAGCGGTCAATGCATTCATTCAGGG
ATCGACCGTTGACCTCATTCGCTATGCTGACCCACCGTTCCTTCTTATCCATGGATGCCGAATACTTCTTCAGAGCCAGATCAAGCTCCCGCTGCTGCAC
TTCTGACCACTCACTGCTGCTTACGCTGTTGTCCTCCACACTTTGTTTGTTGTAGCCTGGCGAGTCGTATTTCAACGTTGTGCCCGCTTGGCTGTCCTTC
AATCCGGTACCACCTTCATTTAGAACAACTACACAAGCCCGCGGCATGCTTTCCAACTTCTCCTTCTGACTCTTCTGTTTGGTTTCAGCACTCTTTAGGT
CATGAGAGAACTTACAAGTGTCTTCATCACGGCATCCCTTCTGTGCAGAAAACCTGCATCTACGCGTTCGAGTCTTTTTTGTTGTTGCAGGTGTTTCTGA
CACTGCTTTTGGCAACTCATTCGACAAGGCCTGACTAACTTCCTCGACAACCGACACTCCAATAGTGTCAAGACCTTCACCCACCTGTTTTTGCTGTTTC
TTGTGTGAGAAATTGCACCTTTCGCCCTCTCTGCAATTACCGCTTGCAAAAAAGCGACAGGCTCGTGGATGTCGCTTTCCTTTCACTTTCTTCTCACTCG
ACGCTAGCTCCTTCACTTCAACCACCAATGTCTCCAGCTCACAGCTCGAATCATCAGCTACTGCCGATACTTCCACTTCTTCTTCTTCCTCAAATGGCGC
AATAATCTGCCAAAAGTGATTGTCCATCCACGTCAGCAGCTTCCGCATCGAGAAGCCACCGCACAGCTCCGTAGCCCGAGCGTTCACTGCTGCATTCAAC
GCATTCACTTGATCTCCCGATAGTCGACTACTCCACTGTGAGAAATCCACTTGAACTGCTTCCATTGGGTAGTTCTCAGGTATCTTCATCTGCAGTTTTA
CTTGACCCTTCAGTCGCGTTGGCAGCTCTGGCGCTGAAAGACTGAGGAAGAAACGCACGCGTTTTCCACCCGTCGTCACTGCTGCAGCATCCTCTTCGAT
CTGCTGCAAGTGGTAGCGACGTTTCAGCGCCATCCACTCCTGCTTGGCAGCGTCCGTCTCGCTCGCAAGCGCTTCTCGCCAGCTCTGGTCAGTCATTATC
CAATTTGAGAATGGACGCTATAGCGAGTAGCGCACGGGAGCAGCTACGAATCAATCTGATTGGCAGAAAGATATCTGTCGTGTTTTTCAGACAGAACGTT
CCTGGAGCTTTCGACCTAGTGCTTCTAAAAACTACTAGAAAAAGACGAAAGTGTATACCGTATACGACATCTCGAAATATGTGGAATGTGCGTCTGCGAG
GGCCTCGAGGCAAGCAGGTGGTGCTGACGATCGACCCGGATGCGCATTTCAAGACGTTTTCAGGTACGTGGTATACACGTATACACCTATAACTGTTTAT
GAGCGTATGTGCATATATCGTTATAACACCTATCGGACCTGTGTATACTATTTAGATCGTGCTGCCAATGATTTGGGGCTGGAAGTTACGGACCAACTGA
CGTGTACGTGCTTTGGGTTATTGGCGCTTTAATGGGTTAATTTTTAGCTCATTTGGTGTATTATTTGTGTGTCTTTTGCAGTCCGAAGGGGATTTCCACC
TCGAGTTATTGACGTGGACGGCTCAGCACTCGTGAAGGACGTCGTTGTGAACAACGATACGATTGTAATGGACACGAGCTCTACTGTAGTGGCCACTGAA
CAAGGTGCTTCTGGACCGGCAGCGACGACCAAACGATTGACGAAAAAGAAGCGAGTGGATGCAAAGAAGAAGGTTGCAGGAAAAGCACCGACGGGTGGCG
TACAGACGCTCAAGCGGCCGGTGAGTGGAACGAAAAAGGCGCTTTCGAGACGGAAAATTGCAGGTCCTGGGCACCAACTTGGGACATCGTTGGACGATGA
ATCATCTGCTACTGCGGAGGTGGAAGGAGGTGAGAAACGGGACGACGAGCGACAACGGACATACCGGCGCAGTCGAGCGATCAATCTCACATCGAAAGAG
GATGTGGAGACGAGTCTAGTTAATGCTGTGAGTGGCCAGTCCAACGATCGGAAAGCAAAGTTCTTTCGTGCTGCTACGAAGAATGCGGTGGAGCACCAGT
ATGAATTGACGCTAGCTACTGCGAGGCTGAACGCGGCATTGAGCCATAATTTTGAAGTTGAAGAGCTGGCAACGAGTCGACGCGCCGATGGCAGCGCTGC
TATATTGTGTGTGCGATTCAAGGAGACAGCACGCAAATGGAAGGAAGAGACTGTGGATCTGCTCCAGAAGGACGAACTGCAGGCAATTCTGAAGTACGTT
TTGCTATCAGGCGGTGAGACTGGGCGTGAGATGCTGAAGCCGTTTAACATGGCTCAAGTATCCACCCGAGTTTTTTGGAGCATTGCACGTTTGTATGATG
GAGATGTGGCTGTTGGCTTGGCGGACCTTGTGCCGGATGAAGACTGGTCGTTTTTGGACATTCGTACACGGTACGTTGTGCTGTGCTATTGCTTACGGCG
TGGTTTGAGTTTAACCGTGCAATGGCTCTTGACAGACTGATGTCCGCGAAGGCTATGGAAGCAAAGGTACGATCCCGATCCCGTATTTGCTGCTTTTAGT
CAAGATACACGGATGAATGACCCTATACTTGTGTCTGTTCACATCCTGTTCCCATCCAGGCGAACGAAGAGTATTATGCTTCGTGGAAGCAAAGCCGTGC
CCGGGGAGATGGATCGATTTCTCAGCAGCCAGAGAGAAAGCAGGGGACGAAAAGAAGCAGACCCGGTCTAGCTGATGAGCAGAAGTCAGAGGTGGGTAAA
ATCGACCCGGATGTTGACAAGAAGGTTAAGCGAGAGGCTGCGGAATCAAAGTGTGCTCAGACAACCTCGGCTCTCTTGGAGAAGGAAGCAACTCCTAGCA
CTCTGCGGAGTGCAGCGGCACAAGCAGCGCTATCTCGATATGATCGAAGCTCGCAGACAAGCGCCGCTGTAGCTGCGTTTCTTCATGAGGAGGGCCCCAC
TGAAGAATGCTCGAGGAAGCAAGTTGTGGCCGGGGACGGAAAGGAAATGGTGTCTGAGGACGAGGTGGAAGAAGCTATCACAGTGTACTGTGACTCTTGT
CGAAAAGCGCGCATTCTTTCTCCCGACGAGGCAGGCAAGGTTGAGCTCGATAACGACCCTTGGAACTGCTCCAATTTAGCAAAGATCGGACGTCGTGGCG
GATGTGACGAGGTCGACGATGAAGTAGCTCAACTCACCGGCGCTTCGATCGCAACATGGCTCCAAAAGGTGGCTGTCACAACCCGGCGAGAGTTAGCAGA
CACCTCTGTGGATAGCGCTATGCATTCTCTCGTGAATCCGTCCGACCCGTCAGCTCCGGTAGTGCGGGAAAAGCTCGAAAAGCTGATCGATGAGGTGAGA
GAACGGCGCGTGTTCGATGTGCTTTGATCATGATTGTTGACCTGGGGTTGTGCATATGCGCGTTTGTTAGGCGCGTCTCGACGAGATCAATGACTGGATG
GCGGAACTTGTCGGTGAAACGGATTTGGTGCAGCGGCTGGAGACCCAAAAGCTTGGTACCCCGGCCGATCTCGTTGCAACACCGAGCGACTTAGTCCTTG
AAGCTGCTAGCAACACACATACAATTAACATGCCAATTGATATGGTCAGCTCCTGGCAAACGCGGGCTCAGAAGTTGGTGGACGAGCACCCTTGGCTGGC
AGACTGGCGAACATTGTAGAATGTGAGGACGCGAGTTCTCAAGATCAAAACGAGCTTTATTTTCGAATTCATTTCTGTCTTCTTCGACACGCCACAGGAG
GGAGATGAGCAGCAAGTGCATGGACTCAATTTGACGAACTTATTGTAGCGCAACTCGTCCGCTCCTCGTATCACTTCATGTTTCAGCAAACTAGAGCCAT
ATCTTCGTTCTCTGGATCCATCGTCCCCTCCTACTCCACGTCTTAACTTCACCAAGTGTGAATTGCTAACTTGCTGACCACTCACTTAGTCAATCTTAAT
CGAGCCGTAAATCTTGCGCGTAAACCAGAGACAAGCAAAGTAGCCGATCGTTCCCGTAAGGAAGAAGAACGTCACTGAAATCAGGAACATGTAGCCGAAG
TACAGAATACCGGAAACGAACGCCGTAATGTTCAGCTTCGTGAAGAAGTAGAGGAACGAGTACAGGAACAAATACACGGCCGCAGACCCCGAAGTAAGGA
ACGAGCGCCACCACCAGCGATAGTCCTCGGCGCATAGCTGGAAGTAACACATCACGACCGTCACCTCTGCGCATGTTGCTACCAGGATCAGCAGCACAAT
AAAGAGAAAGCCGAAGACGTAGTAAATCTGGTGCAGCCATAGCGCCGACATGATAAAGAACAGCTCAATGAACACGGCGCCGAACGGCAAGATACCGCCC
ACCAGAATACTGAAAGGGGAGGACAAATACCACACTTGCTCCGGGATCTGGCGGGCAATCTGATTCGTACGCACAGGATGCTCAATTGCAGCAGCCTTGA
AGCCAAAGTAGCTGCCGAGGAACACGAGCGGCACCGAAATGCCAAACCACAAGACCAACAGAGCGAACAGCGTTCCAAAAGGAACTGCCTGCGACGATGC
CTTGCCCCACAGCACCAAGTTTAGCAAGAAGAATACGGTGAAGAGCAGGCCCGGGTACATCACAGCCGTAAGAATAGTGTTTGTCTTCCAGTCCTTGCCG
CTGAACATCTTGTACGTACGTGACGAGTAGTAGCCAGCAAAGCTACCCATAAATACAAAAAGCAACAGCAGCGTCGTCAGCAGCGAACCGCGATTAGCCG
GGGATAGTAGACCCAGCAGCGCGACAACCGTCGTGGAAGCACTCATGCAGCACACCTGCACACCCGTTCCAACAACCACGGAAAACAGCATTGGCGAAAG
CTGTGGCGGACGAAACACATCGCCGTGCACAAGCTTCCACCCTGACTCTTCCTGTGCCTCCTCAGTGGTTTGCACCTCATTATAGCGCGATATATCACGA
TGAAGCGTGCGCAACATGATCATAGCAATCATGCCAGTCAAAAACAGCACAATCATGAGCGAGTTAATGATGGAAAACCAGTGGATCTGGTCGTTCGAGC
TCTTGCTGCTAATAATGCGGTCCCAGCGCTCTTCCCAGACAATGTCTGACTTGACAAACTGCACGTCGTACGTGTAGAGCACCGTCGTCTCTCCATCTGG
ACTCAAGTATTGGTAATTGCCCTGCGACACTTCTTCAACGTTGACGAACTTGCCACACGTGTCCGAGTCAAGTTCCTGTCCCGGCATGGGTTCATTCTCG
TATCGATGTTTAATGGACGTCGGCACGACTTCAAAGCCCACGACGCGCCACTTGGGGGCATCGCCATTCTCTTCCGCGTACGGATCGGCATTGACCGAGA
TAATGATCCGGACGTGGTTGTAGAGCAAGTAATTGCCGTCTTCATCCACTTCTCCAACCGGGAAGCCACGCTTGAGCGAGCCAGCTTGCTGTGTGTCCGT
TGGATCCCGGTAGAGCACCGGGAGGTTGTCCACGACCCACTGCACGTAGTACTCGTCCTTGATCATGTCAATAAAGAGCTGCGACTGCGCGGCCGTGTAC
GTCATGGGCTTGCACAGCACTTGACAGAGGGCGTCCTTCTCCATGTGCATCTGATAGAGCGACTCCATGATCGCGTCGCCGGCCATGATCTCGCCGAGAT
TCTCCTGCTCTTCGCGGATCGTCGAGGGTTGACAGTAGGGGAGGTAGTAGTACTCGTAGGGCACCAGCGTCTTGGTGGACGTGATCTTGTTCACGTTGAG
ACGCACCGTCTCGCCTAGAGCCCAGGATTCGGGCGCAACGCCTGGGACGTAGAACGCTGCGTGTGCGTGGGGGAGAGCCCCGAACGTGGCGAGGGTTATG
GATGCGAGACGCTTCATGTTTGGGGGAGTGTGAAGGGGGGAGGGAGAGAGAG