Description :
From Genome Similarity Track
Location :
contig_64:239292- 240463
Transcript NameFunction/comments
g11061.t1KUF77673.1 hypothetical protein AM587_10010976 [Phytophthora nicotianae

Sequence
1171 bases(100 bases per row)
TAATACACCATAGCACGGCGTTATTTACAAAGTCAACACTCAAAATCAAAAACCTGTCAGATGTATTACCCTTGAAAATGATACTACCTCTCAGATCTTA
TCAAAAATACGTCCCAACTTCCATGTCCTCAAAGTGCAACGCGCACTGGTGATGAGGCAGTGAATGGCAAAACACTCGATTGCGCGCTGGAGTCACCAGT
TCGACAAACAGGGGGTCTGCAGCGAGCTTGAGATACCCGGCGCGATGCTCCGTAATCGTTGTGCCGTCGGGGACGCGCAGGATACCAGGACGCTGTTGCG
CGAGAAAGCGTTTCACAGCACTCTTGTAGACAGAAAATACATTCCCTATCGGGTTCAGCATAGGGGAGTATGAGCATCTCGGCATCTTGGAATTCCTCCT
CGGCGAACACATCCTTAATGTTGGTGTGACACGGGGCATTGTCGAGCACGAGCACGACTTCATCCAGAAGGGTGGAGGTCTTGATGCGGCGCAGGAATCG
TCTGATAAACTCGTTCGCGAGTCCAGCAGTGAACGAGCCGAACTGCGACTCTTGGTAGGCTAGGCCAGTACTTGAGATAACGGCAATAATATGAATATTT
TTACCCTTACTGGAAACACCAGTCTGTACTGCGCACTGCCCCCGCTTGCTCCAGCCACGCCCACGTGAGCACGACCAGTTAAAGTTCGTTTCATCCAAAT
AAAATACCTTCTTGTCGTTAGCGAGAGCTGCGTAAAACTTGATCACGTACTCGTAGCGTTTCTGCTTGTTGATTGAGCTGTTGCGGTTCACAACGTCTCA
GTGCAACGTCTTGAGAGTGAAGCTGCGGGCATCTAGAGCGCGCCGTACGGTCTCCCGGTTGATAACCACATCGAACTTCTGCTCAACAAGCTGTACCATC
TGGACTAGCGTCAACTCTGGCGTCGTTTCGATCTTACTGAGCAGGTAATCGTGAACAACAAGTAGCTTTTTAGATGACCTGCCGCGTTGGTGTTGGTCAC
CACTCCAGTCTCCAGTCTCCATGGCCCTCTTGATCTAACCCCATGCAGTACGCTCGTTGACGGTGTAGAGTTCCGCCACGGTTTTCCAGTTACCAGCATT
ATTTGCCACTCGCAGGATAGCCGCACACACCTAGCTTGGGTACGTCTTGTACTTGGTAGTTGGCATGGTGC