Description :
From Genome Similarity Track
Location :
Scaffold_10:239247- 244290
Sequence
5043 bases(100 bases per row)
CCCGTTACACCTGGTAGCACTTTGTAGTCCGTCCAACGACCATGCAAATGCTAAATGATGAATCTGAAGACATCCATCCCCCGCATGGGAGCCACTCTCA
TTTGAGTCAAATCGAATGGGATGCCATCGAACGCTTGAGTTCGACGATAGGGCAAGAAGCCGTAGGCGCAAGGCTGTCCGCTCTGGGTCCAGACGGGCAC
TTCGCTACCATCGCCATGTTTATATAGAATGAACTTGACGCTGAACGGGGAAAGGTAGCCTTGCTTCACCAACAAGGGTCCCAACAGACAGAGCTGTTGA
GAAACAGAGTGCTCAACAGTTCGAGTTGTTGAGACAGCAGCAGGCTGCTGCCACCGGGTCGACACACTCTCGTCGACCCGGATAACTGAAGATCGACATC
TCTAAATACAAAGCGGCTGAAGAAGATTCTCTGCTGAGATGGTTTGTTGAGCTAGATGACGCCATAAAGGCTTGTCACATCGTCGATGAGCAAATGCAGG
TCTCATTTGCTCAGTCGAACTTGGCAGGGCGTGCGAAGACTCGGGCCTTGGGCCTCAAGCTACACGACCCATTTGTCTTTGGGTCGTTAGAAGTCTTCAA
GTCCCTGCTTCGGCAAACATTCGAACCACCGCGAGCTGAGTTCAGGGCTCGATCTGAACTCCTGAAACTCAAACAAGGCAAGCGTGATGTACACTCTTAA
ATTCAGTATATACGTCATCTTACGAGTTGCATCACGTCCAATCCGCCGAATGAACAAACGTTGATCACGTTGTTCATGTAGGGTCTCACAGACGGTCCAG
TCAGGACCTATCTCTTGCGGTTGGATTTTGATACCCCGGAAGAGGCAATCCGAGTTGCGGAGCAAGAAGATTACAGTGTGAAACAAGCCACGTGAGTTCG
AGTTCCTATCGTCCCCCGAGGAGACAGGAAAGCGGATGCCCAGAACCGATGGACCTCTGTTACGCTGAGAGTGAAAGCTCTCGCGTTACCAATTATAAGG
CATTGCAGCGATGCAATAGATGTCAAAAGACAGGGAATTATGCATACTAATGCAGTGCCCCGAACTCGGTACCACGTACCGCAGGAAACAGTAACCGTCA
AGAGGCCAAGAAGGGTCCGAGGCGTGGGTCCGACGCTGTTTCAAAAACGCAACACCGTAACGGACGACCAAAAAATGGTCAGGATCAGTTGGTGCGGAGC
ACCCTATTGATCCAGCAACTTCAAGTGAGTTTGCAGGCCTCTTGACGAAAGTTGCTCCCAACACTCAGTCATTGTGTGTTGCTGCTTCTGGTAATGAGGT
TTCCCTCATTACTTGAAGCTCGAAGTGGCAAAGGACATGTCACTACGATCCCTAGTCGATTGTGGGGCGTCAAACAACTTTGGACAACACCAATCGCTAG
ACAATAGCAAGCTCACATACATCGAGCGAGAGCTCCTCGAACGAAGATGACGGTACGCCTCGCTACAGGCGCATCTGTAACAGTGATGAAACGTGTAGTA
GGAATGTCCTATACACTGAAAGAAGTCCAATACGATGATGACTTCATCGTCTTGGACTTGGATAACAAAATTTAATGTTATCCTTGGTTTACCGTGGCTC
AGAAGTTATGAGCCACAAGTCAGCTGGCATCGACGAAGTGTCGATATGCCCGCGCTTTCACCAGACGCCCATCTGATGAACATCTTGGAGCGTCCACCAC
CATGTGGATGTACTACGAGTGAGTACGATGGCCTCACGTGTGGTTCGGTCGTTAGTACGACTGCACAAGATCTCAATGTGACTTATCATCACATTGTGGA
GCAATTTCCCGGCGACCGCATAACAATGCAGGAAGCGCCAAAGGCCCACCACTCGAATTGATAGAGCGGACCGGGGCACGGGTGTCCTCTTAGTGGACGA
CACCCAGATCATGACCAAACGATTGCCAACGATTGTCAATACGGAGATAAAGCAGCCCAAGAGGCTAGAGTTGAGGGAATAAGTCCCCAGCGAACATTGG
AAATAAGTTCCCATGAGACGACAGAGAGATTGAATGTCCTAATTAATGACGAATCAAGCATAGGTAGTCATACACTTGATCTGATCGCGCCTCCGAAGTT
GACTTCGGAGATCACTCAGTTACCCCCGCTGAACCAAAAGAGGTTCTTGCGTGATCTGCGTAGTGGCAAAGTCTAGCAGATCTGCGTACTCGTCGTGGAG
GGTCAGTACGTTTGTGCTATACGATCGGCAATGGTCTTTGCCGAGGACGAAAGCGTTTTCAGTATCTCATCAATGGACGATAGTGTCCTTGATGAGAAGA
CTCGGATTGAGCAATACACATCCCAATGGTGGGAATCGCTCAAAGCAAATTATCTCCACGATAATTTAATGAAATTCAGGGGTGTATTCCCAGAAGAAGT
CCTGTGCGATTTACCTAAGGATAAAGGTACTCGTCACGAAATCGACCTGAAACCGGGTTCGAAGTACTGGGTCATAAAGTAATGGCCACTGCCTCGTACA
CAAGTACTAGCGATCGACATTTTTTTTGCAGATCGCTGAGCAGCCGGACATATGAGGGATTCCACCTCTCCATATAGCTCTACGACCTTGTTTGAAAAGA
CACAGGAGGGTGGCGGATAGTACATGCCTCCAACAAGTTGAATGCTGCCACTGTATTGGCTCAAACACCGATACCAAGGAAAGATGTAATCATAGATGGT
ATGGATAAGAGTACCATATTTTTATCCATGTATCTGATGGATGGGGTCTATCAGATCCATATGCACAGAAGAAACATTCCCTATACTGCAGTGAGCACCC
CAAGCGGAATGCTTTGGGAGTGGTTAGTCCACAAGGGCTAAGTAATGACCCTGCCACATTCAACAGATGTGTAACGAATCTATAGCGGCGTATTTGCACA
AATATTCGCGCGATTACGCCGAGATGAATGTTCATCTGTCTCGTTTATTGAAAAAGAACGAGAGGTGGGTATGAAGTGCCGAATGTCAGCGCTCTTTCGA
AGGTATCAAGCAAAGCTTGATACGATCGCCAGTTTTGGCGATTGCAGATCAAGACAGACCATTCCGTGTAGTTTGTGACGCTAGTGACTTTTCGATCGAC
TGTGCATTAATGCAGTATTATGCAGACGATGCGGAACGTGTCATCTGCTATCAGTCACGCCAGCTGCAACCAGCCGAACGCAACTACCCCGTCCATGACA
AGGAACTCCTTGTCATGAAGTACGCACTGGCTAAGTTCAGAGTCTATCTGCTAGGTGATAGACCCTTCATCGTTTTTACGGATCATGCGTCTTTACGCAC
GGCCGTAAACAGTCCACACCTCTCGCAGCGGATGCCGAGGTGGCTGTCATTCTTTGCGGAGTACAACCCCTCCGTCGAGTATAAGCCAGGACGCCTTAGA
GTCTTTGCTGACACGCTCTCGTGCCGGCCCGATTTCGAGCCGGCTGCGCCACCCGACAATGGCCCGACCACTGTCGCGGTACTGACTTCGAGTGTCCCGT
CATCAACCTTATTGGAAGACATACGAACAGCTTATGATCTGGGGATGGTGCGATTGCTGCATCATCACTTGCACCTATCCGGAAAGAGCCTCAAATAGTT
GTCGTCAATATATCGATCCTCTACGGATGGATATACAGTTCGCAACGGCTTACTCCAATACTCGGCGATTGCTGGCGACATGCTTCGTGTCGTCGTACCA
AATCATGGTGATCTGCGATTGCGTATCATGCATGAGTACCACGAAGCACCTGTTAGTGCAAATCGTGGTCGTGAGAAAACATATCTCACATTGAGCCGCA
ACTTTTACTGGCCCCGCTAGTATCAGTTTGTGCGCAAGTACGTTCGGGCCTTTGAGATCTGTCAACGGGTGAAGTCTAGCTTCTCCCTTCGAGCCCCGTT
GTAGCCTCTGCCCGTCCCGGCCGAGTGCTGAGAATCTGCCTCAATGGACTTTGTCTTCGGATTCCCCGCAGACTCTCACAAGAATACTGGTATTCTTGTG
TTCGTTGACAGATTCAGCAAGATGGTACATCTACATCTGCTGGTTAATGTATCTGAATCAATCAAAGCATTGGCTTATGCTCGTTTCTTTATAGACACGG
TCTTTCGTCTCCATGGTCTGCCTCGTGAACTGGTGTCCGATCAGGACCCGCGGTTCACAGCTGAATTCTGGTGTTTCTTGTTCAAAACACTCGGAACGCG
CTTAACGATGTTCACGTCCGACCATCCTGAAACAGATGGTCAGACCGAACGCGCCAATCGTTCCCCCGAGGAGATCCTTCGAGGATACGTCTATTCCTTT
ACGAATCGGAGTGAATTTCTGCTGATGGTGGAGTTCGCCATCAACAATTCAGTCCATGCGTCGACGACGCACACGCCGTTCTTCGTGAATGGCTTGCGCC
ATCCGTGTCTTCCAACCGTTTTAGAATGTGACTCTCGTTTAGAGGGGGAGGGACTCGCTCGAGCGACCGTCAATCCGGCTCTCACTCGTCACGTGCTTAC
AATGCGGTCACCACGTTCGACGCCAATGTCGATCACATCGGCTTTGATGAAGAAGACGAAATTAAGAGCGAAGATGCTCTTAATGGCCACGATACTGATC
AAATAAGCATCACGCCTAGTGCATCCAAAGACACACTCACAGAGGGCACAAGTGATCTTGCTACAGTACGCTCCAAGAGCACTTCAGCTAAAGACAGCGA
GTCAACAGATGAATTCATACTGGCTCGCAAAATTCATACTGGCTCGCGAAACCGTTGTCCGTGTCGTACAAGAATCTATCGTAGAGGCGGTAGATCGACA
AAAACGAAACGCTGACAAGAATGGAAGGGCAAATGTTCTTTTATTCAATAAAGACGACCTAGTCCTACTATCTACGGTAAACCTACCCCGACACATAGTG
ACTAACGTGGGAAGTAACAAGTTACTACCCAAGTTCATCGGTCCATTTCATGTGCTGCGCCGCCTAGGAAAACCATATACGATTGAACTGCCACGTAAGA
TGCGCATGCATCCTACGTTCTACGTCGATCGCCTTAGGCCGTA