Description :
From Genome Similarity Track
Location :
Scaffold_326:2392- 7252
Transcript NameFunction/comments
Phyta_totarag7144hypothetical protein PHYSODRAFT_348160
Phyta_totarag7145hypothetical protein

Sequence
4860 bases(100 bases per row)
GATAAAACCATTCCAAGGTTTAAGCTAATCTCAAAAACGTTGCATGCATCTGCAGACCGGGCTTACAGTACGACGTACTGTACGTCGCCGAAGTGACCTC
GAGGGCCACCATGTCTACCGCCACACATGTAAGCCAAAAGTCTCAACATCTCGGCCCGAGACACACCGGGGCGCAAGGAAGAAATATCCAGCCGATGCAG
GTTCCAATATTCCAATACTAAGTATGGCACTAAGATAGCGGTGGAAGAGTGCTTTGGCTCGGCCTTCCTCGCCTTCTGTGTAGGACACTGGTTCATTCGG
CATGTCGTTTCTCAGGGAAATGCCAAAAACCAGGCTTCATCCACTCGAAAACTGTAAAGTCATGTATGCCAAGTGGTAGGTCTATGCTAATAGGCGATAC
AAGTTAGCGTTTACGTACGGAGCTGTCGGGAGAGACCGGAGCATAAGACATCCGCGATGCAAAATGGACATGGACCTCTGTCTGACCAGTCGAACCCTGC
CGGCTTGGAGATTCACTTCTGATCTTCCCACCTACGTATCAGACGTGCAGCATGCAGTCGCTCCGTATCATCGCTCTAGTCGCAGCCTCGGCGCTCTGCA
TCGGCGCGCAAGGctttgaagcagcagcaacagcagagacgtcctcctcttcttcttcttcctcaacCTCGTCATGCTCAGgagacgagctgcagcaggt
gcaagCGCAAGTTGCCGCGATTCGCGAATCATTGGGGTCGGAAGccgactccagcagcaaggccaCGAGTGTGCCGTCAACCTGCAAGGCGGCGCTCACC
TTCGACTTGTCGgcagccagcgacgacgacgaagagaacTGTGCAAACGACTGCATCAACTGGATTGAGGACATGGTGGACGCTCCGACCTGCGGAGACG
AAGAGATGCTCACGTACCAGCGACGCATGGCTGCGTACCTGACACAATGCAACGAACGCAAACAAGTGAGACGGCAGGAGACGGACACTTTCGAGCACCG
CAACAGACTGCGAGGACTGGCAGAAGGGCGCCCGGAAGGTCGCAAACTCGGTGTCAAGGGCCTCATGGACGCGTTACTGGTTGTTACGCTGAACAACGCG
CTGTAACGACGGCACCGGTGGACATCAAGACTATTTATCGGCACATGCGTCGAGCGTCGCGTGTGCCGCAAGTTGTAGGAGTAGCAGCGAATGTGATTCG
AATGCAGCACACCTTTGTTTCTGTTGGAATTGTCAACATGGGGTTGCTGTGTCAGTTGCTTTGTTCGCAAACGTTTGAACTCACCGCAGCATTTTACATT
TTCTTTGCATCGTCGGCATGACTTCGACAATCAACTAAGCATAACCCCCTGCAGCGAATCTTACCACCACCACTAGCAAGACAGGCAAGTGGTGAAGACC
TGCAACATGAAGAGATAGAGATTTTACATTTTTAAATATAAGGTACTGTGCCAGTTCCGTGCCTGCAACCAGTTCCGTGCCCGcttagtttcagccaatc
cacaagcTAATAATATTGAAGAAGTAAGctattggttaaaagtcGGTAACCNTGCCAAAGTACACGAACGTCGATCTCAACGCTGCGTCCACACTGGCGA
GACTCGCCGTGCCGTCGGAAAGATCTACTcttgcttggtttcgtcAATTTGTGctttctttttttttaagtGATACGATATCTCTGTATATCTGAGCTCA
CTATCATTTCAAAATTTGGatttattattaataacctCAAATTCTCCCCAGGCAGGGAGGTCATCTGCCGCATTTACAGTTCTCTGACTGCCCTCAAATA
TTCTGAATGAAAGTTACCATCTTAAGTGATGAGTTGAGTTTATCCTGCAAGGCGGAATCGAAGAATCGTCCTCTCGTCTAGGCATTTATCACGAAACTAT
GGCAGCGCTACATAATTCTCCTGGACTANGTAAAACCGCAGTCCATAAGataggtacttcagcaaatctgtgATAAAATCGAGAAAGGAAAGCAGTTTGC
AGGCATGTGCTTACTTGTAAGCCAATAAAAAGTTATGATCTGAACAAGGTAGCCCTTTCCAAATgggcacgaaactggcaccGTACTTTACATTAAAATG
TACAGATTGAAGCACGGACTCGAGCAAAATGAATACAACAGCGTCCACCGGAGCAATTGTTTCTCAAAGGTTTCCGAAGTTGGAGTGCCATCCTCATCTG
CACGCACAATCCAATATTTAAAACAAATTACAGACAGATAGATCTCCATCACGCCAGGAAAAAGGCATTGGAAGCGGGAAAATCAGATAGGGTCTAGGCT
TTATACGATTCGTAAGCGGCTGGATGGCTTGTGCTAATTGCACTTTAAAATGTCCAAAACCTTTTGCAAATTACATACTTCATACATTGCAAAGTGTAAC
TAACCTCACGAAGGTCAGTGACCAAGCTGCAGTTCACCCTGCTCGATGCCGCGAGCCGCATTCGTTGAACGAGTTTGTTTTAGGCGTATTAAGGGGTTAA
ACTTGAAGCAGTAGTGTAGCTAAAATTCGGACGTATCCCCCAGCGCCTCCATGTGTTCGTTGTAGAAGACATCGTCGTCAAGCGTTATGGTCTCGCTGCC
CCAGTCGTTGCATTCCTTGTGTACGAAGAGAAGCGCGTCAAAATGGTTACCCTTCAAAGCCAATTTCATGGCCTTCACGATGGGATTGCAATCGTCGATG
TCATGTATCGGCGGATGATCAATCAGCCACCGAAGGATATGTAAGTGgccaccacgcgctgcacaATCAAGCGCATAGATCGAGCACCCTTCGTCGGGTC
GCTTGGCGAGCAGCCATTTTAGCACGGACAAGTCCCCGAAGCCTGCTGCCTCATCCATCACGTCGGTTCCGTAGTACTCGGAGCGGTTCTCGTGCAACCA
CTGAATTACTGGCAAGTGGCCACCGCTTGCAGCACATGCCATGGCATCTTCGGTCGACTCGACAGAGGTGTGGGTGCAGACCCACTGCACTACGTCCAGA
TGTCCATTTCTGGCAGCTTCGACTACCACGTTCTCCATTTCGATGACACTGGAGTGTCGAGACTTTTCACctcgcttcctcttcttcccGGCAAGCGATA
GCGCCATTTTGTGGAGATACTGAATCACTGGTTGGTGCCCATTACTGGCCGCTTCGCTCATTTCACGGATTAACGGTGGTGCTCGCGACACGAATTCTCC
CCTGCCATACACAGATAGTAGATCCGCGTCTGGATCTTCGCTAAACTCTGACCACAACCATTGCACGACGTCCAGGTGGCCGTTCTTGGCAGCACTCTCC
AGGGCATCACGCCGGCACAAAGTGAACCCCTGGGAATAAAGATATTTAGCAACCTCCAAATGTCCGTTAGAGGCAGCGCTGTTCAAAGCAAACATACTCT
CTTTACCGATATTGTGTTTGAGAAGCCATTGAATGACCTCGAGATGGCCAACAGTCGCTGCAGACTCGAGCGCGGCCTGAGCTGATTCTGTTTCAATGGT
AACGCCGTTCGCTGTCACGTGATCTGCTAGCCACCACACAGCAGGTAGTGGGCCTTCACCACAGGCTTCCACGAAGGCATCACTTGCGCCGTTTCCTAGA
CCAGACTCATCCAGCCATTTGATAACGTCCAGGTGCTTGCTTGGAAGTTGAACCCAACGTTCATCACCCGCAAATCCTTGTTCAAGTAGCCATTGGAGTA
GCGGTAAATGGCCTTCCATTGCAGCCCAGTCGACCAAACATGCGGGATGCTGTACTTGGAAGCCATGCGGAAGCAGCCACTGAACAAGCGACAGATCCCC
CGACAGTACAGAATACCTTAATACGTCGATTTGTTCGCGCTCTGTACTGCTAGTGTTCTCGTGGAGCCATCGTACGATCTCACCGTGTCCATTCTAGGCG
GCCAGCTGCATATCCTTACCGCCCCAAGTTACGCTGTTACCCTCCCCGACAAATCGATGGCCGCTAGTACCAGCCTCATATTCTTCCTGCGTGTGGCCGC
CATCCTTTTCCAACAGGAATTTAAAAATCTCCAGCTGTCCCGTTGAtgctgcctcctccaccacttccaccTCACTCACGCAGTGGGTAAAATGACTGAA
GATCCGCTGAGCAATGGCCAATCTCGTCTTCGAATCGCTTGTATTAGAGACTGTGAGAACTGCCACCGCTGGTAGTGGCGGTTCGTCTGCAGTGACGCGG
CGgggcaccagcacctgtTCTTGCCGCGAGGGAGCTGGCTGTGGAACCAAATACGATCCAGGAGAGCAAGTGTGCTGCCGGTGCTTGGTGTAGCGAGATG
TTCACGGTGTAGTCCAGGAACGTCGAGACGAGGGAAAACACATGCGGTAGACTGGCGATAGCGAGCTTATCACGCAGAGCGAGGGTCACAATCGAGAGTG
GCGGAAGCGGCAGTGACTCCATGCTCGTATATTAGGGCCCGCCACGAATTATTATACAGATTTCGCTCTCACTTCCGGTAACGGGTCTAATTAATAACCT
TTGTCGGATTTATACTATTAGTTTGGGCAGGTACGGAGAGGTCCAAGGTCGCATTTTTGAATTTAGGCGCAAAAATGCACCCAAAGATTCGCATCAGAGA
ACAATCTGCAAACAATGGGGAGATGGATGCAGATTGAGacaccagcaagcagcacgatgcgTGTCCTGAGCTGTCACAACACGAGCTATTATAGCTACGT
GGGCAACGATAACGTAGTGTACAAGCAACGacgcgagctccagcgcagACTACAATTTCTGGCATCCTCAAGAACACTCCTGCCATCATGAGCGAGGCCT
ACGGCGACGGCAAGCATCGAGGAGGAGCCCAAAGGCAGCAGCTATTTGGCGTCGAGGAGG