Description :
From Genome Similarity Track
Location :
contig_48:23913- 25445
Transcript NameFunction/comments
g8343.t1hypothetical protein
g8344.t1hypothetical protein PHYSODRAFT_349597

Sequence
1532 bases(100 bases per row)
CTACGAAATCCAGAATCGCGCGTCGGCATCGGAAGACGGCAGTGACCTCGCTGGCACTGGGCGACGTCTGCGATTTCGTAGCTGCCATGACTTCATCCCG
CAAGTTCTTGACCACCACTTCCTGCGATCGGTGCATTGCTCGCCAGACTTCACCAGAGGCGCCAGCAGCCAGCTTCTCTTCCTTGACAATTACATCAAAG
TCGATACAATGCGAGAGCAGCTCTTCGTCTTCCCAAATGGACGAAATACTGGGCAAGTCTGACAATGACATCTCCTCCCCCTGCAGCTCTGCATCTTCCT
GTTGGTGAGCCTGTGAAAGTTCCGTCTCCGCCCGTTCCTCTGTTATCCCCGGTGTCGGTCTGTACGTGGCAGTGATCCTCATCTGGGGTCCATACTCCTG
GTCGAATTGAATCGACGGTGCCGATCTCGGCGCCTCGCGGTCTCTTCCTTCCTCGGTGTCTCTCTTCCCCACCACGAGCTTCCCTCTGCTCCTGCTTCTC
GACCGCGAGGCCGAAAACAACCCACTAGCGCTGCGGAAGCTGCTACCCGGCAGGGAATGGCGTCGCTTGTTCTTGGCAGCGTCTTCAAACACAAAGTCCG
GGTCGTTCTCCACCGCCTCTGCGTCCGCTCTGCGCAGTGCGTAGCTCTTCATGTGGTACTTGAAGCAGTGCGTCCAGACGCTGCAGGCCTTGGCCGACAC
GGCCTTGAAGCGCTCTTCCTCGGGCATGTAGAACCGCTGACTGTCTCCAGGCAGCAGCAAGCTGCTCACGCGCCGGGCCATCGAGTCCGACGCCTCCTTG
TGGAGCTCCTTGTCCTGCAGGTATCCCAGAGCCACGAAGCTGCGGTCCGCGCGACTCGTGAGCGTCACGTGCGTGAGCACCAGGCGGCGCAGCAATTTGC
CGTTCACTGTGTCGTCGTCCGAGAACACAAACAACGCCGCCTGCTGCGCCTTGAACACGCAGAAGCGGCGGCGGTAGCGGCGGAAGATCCCGCGCCCTTC
GCGACGCCACAGCCAGCCGCTGAGCCGCACGGGCAGCGCCAGCGCGCGCTCCGGAGCCTGCACCGCCGGGTGTTGCTCCTCTAGGTACTCGTAGATGCCC
TGCTCGGCGTCGCGCACGCTGCGCACGGCCACGGCCGCGCCGATGGTGACGTTGTCTGCCATCAACTCTCGAGTATAAGGCCCAGTTGCGAGTGACACCA
GTGGTACTCTTTCGGGGGTATTAGTGGCACTCTTTCGGGGATCCTTGGTTCTGGGATATGCCGGGGTCGAGGCTAGAATCCAGACGCCTCGCACACGTAG
GGGAACCGAGTAGAACGCAGTTTGCCTGCCGCCATGGTGCTGTCGGCTGTCTTCATCACCGACCTCAAGGGCAAGGTCATCATCTCGCGCAACTACCGCG
GGGACATCCCCATGTCGGCATCGGCCAAGTTCACGCGCTACGTGCAGGACAGGGACGACTCGGAGCAGCGCCCAGTCTTCACGGAGGACGGCTACACATT
CGTGTATCTCAAGGCATGGGGACTATAATTTG