Description :
From Genome Similarity Track
Location :
scaffold_457:23911- 26126
Transcript NameFunction/comments
g8533.t1 hypothetical protein PHYSODRAFT_346539

Sequence
2215 bases(100 bases per row)
GTCGTAGTATGGCGTCTATGGGAGGGCAACCGCAGGCCTGGATCAACCCGCAGAATATCCCGAACGGTGAAAGTCTCAAGAAATACGGGCGGGACCTCAC
CGAAATCGCGAAATCTGGGAATCTCGACCCTGTGATTGGTCGAGAGGATTCTATCCGTCGAGCTACGCAGATTTTATCGCGCAGGACCAAGAATAATCCG
ATTTTAATCGGAGAACCTGGTGTGGGCAAGACTGCAGTGGCTGAAGGACTGGCGCAACGTATCGCGCTTGGAGAAGTCCCGGACAGCTTGAAAGACAAGA
AAGTGGTGGCTCTGGACTTGGCTGCGTTAGTCGCAGGCGCCAAATTTCGAGGAGAATTCGAAGAGAGACTTAAATCAGTACTTAAAGATGTGGACGAAAG
CGACGGGAAGGTGATTCTGTTCATTGACGAGCTTCACACTTTAGTGGGAGCTGGTGGCAATGAAGGATCTACTGATGCTGCTAATATGCTCAAGCCTGCA
CTGGCTAGAGGCGCGTTGCATTGCATGGGAGCGACGACGTTGGACGAGTACAGGAAGTACATTGAGAAGGACGCGGCCTTAGCGAGAAGATTCCAGCCGG
TGTTAATTTCCGAGCCAAGTGTGGAAGATACAGTGACGATTCTGCGTGGATTGAAGGAGAAATACGAGGTGCATCATGGTGTGAGGATCGCGGATAGTGC
TTTGGTGGCTGCTGCGACGCTGGCGAACAGGTATTTGACGGAGAGGAAGATGCCTGACAAAGCTATTGACTTGATGGACGAGGCGGCGTCGAGACTGCGT
CTGCAGCAGGAAAGCAAGCCAGAACCGATCGAGAAATTGGACCGGGAGATCATTTTGAGGCGAATTGAGATCGAAGCGCTACGGAAGGAGACGGATTCAG
CTTCGAAGAAGCGTTTGGCTGTGTTGGAGGACGAAGTGAAGAAGGCGTCGGAGGAGCTACGTGAACTGATGGACGAGTGGAACGCTGAGAAGCACAAGCT
GGAGGAGATGCAGGACGCTAAGCGTAAACTGGAAGAAGCTCGTCGCGATCTGGTTGCGGCGCAGAATTCCGGTAATTATGCGAAAGCCGGAGAGCTGATG
CACTCGACCATTCCGAAGCTGGAGGCGGAAGTAGCTCATGAGGAACAGGAGGAGGAAGAGACGAAGAAGGCTGGAAAGAGCAGGACGTCACTTGGAGATG
CAGTGACAGCTGACCACGTAGCGGAGGTGGTGGCTCAGACCACTGGCATCCCGGCTGCCACTTTAATGGAAGGTGAGAAGCAACGTCTGCTGAAGATGGA
AGACCACATCAACCAGCACGTGATCGGCCAGGAGGAAGCTGTGAAGGCGGTCAGCAACTGTGTTCGTCTCGCGCGTGCTGGACTTCACGCACACAACCGT
CCGCTTGGAGTGTTCATGTTTCTGGGGCCAACGGGTGTGGGCAAGACAGAACTGACGAAATCTCTATCCGAGTTCCTGTTCCAGACGCCACAAGCTCTCA
CACGTATTGATATGTCCGAGTACATGGAGAAATTCAGCGTCAGTCGTCTCGTGGGTGCTCCTCCAGGATACATTGGGTTCGAGGAAGGAGGTACTCTTAC
GGAAGCAGTGCGTCGTCGTCCGTACCAAGTGGTTCTCTTTGACGAGTTCGAGAAGGCCCATCGGGATGTGAGCAATATCCTGCTTCAAGTGCTTGACGAA
GGTCGGCTAACAGACTCACAAGGTCGCCTTGTCGACTTCCGCAACACAGTCATCATCCTTACGAGCAACTTAGGCTCGGAGATCCTTGCGGGACTTCCCG
AGGGTGCTCCCAGTTCTCTGGCTGAAAATGACGTGATGAATGTTGTGCGCTCTCATTACGCTCCTGAGTTCCTGAACCGTATTGACGAACTGGTGTTGTT
TAACCGTCTGAAACGCGAGGATATTCGCTCCATTGCCGACCTTCAGTTGCGTCAGGTGGACAAGCTGCTCGAGGAGAAGGAGTTGACTATGAAGGTTGAT
CCGGAAGCGGAGGAATGGCTGGCTGACGCTGGATACAGTCCGCTCTACGGAGCTCGCCCTCTCAAGCGTCTCATCCAGCAGTATCTGCTCAACCCGATGG
CTGTAAAGTTGCTGGAGGGTTCTGCTTCTCCAGGCCAAGTGCTGCACGTTGAGGCGAATCCAAAGTACGAGGAAGAAGTTCTGAAAGATCCGAAGACCGC
CAAGCCGCTTCTCAT