Description :
From Genome Similarity Track
Location :
Scaffold_1509:2391- 3404
Transcript NameFunction/comments
Phymu_g13362abc transporter

Sequence
1013 bases(100 bases per row)
CCGTGCGTGCTCAGTTGGAACAGTCTCAGCTACTCCGTGGCCACGCGCAAGACGGCCGACGCGCCGgatgccaagaagaccaTCCTGAACAATGTCAGCG
GCCGGTGCGCGCCCGGAGAGCTCACGGCCATCATGGGACCGTCCGGATCGGGCAAAACCACGCTCGTCGACCTGTTGGCCGACCGCATCAGCTCCGGAGA
CGTGACGGGCGACATCGAGCTCAACGGCGAGGCGCGCGTGTCCAAGACGTTCCGAGCCGTGACCAGCTACGTGGCCCAGGAGGACTCGCTGCTGGGCTCC
TTCACTGTGCTGGAGACCATGCGGATGGCGGCCAAGCTCAGTCTGCCCAACAGCGTCACGTCCAAGCAGATCGAGGCccgcgtggacgacgtggtggagg
ccatggGACTGGCCACGTGCCGCCACACTCTGGTGGGCGACATCTTCCGCAAGGGCCTGTCGGGCGGCCAGAAGCGCCGTCTTAGCATCGCAATTGAACT
GCTGTCGAACCCGAGCATCCTCATCCTGGACGAACCCACGAGCGGGTTGGACTCGAGCGCCACGCACAACGTCATGAAGTTCATCGTGAAGCTCTGCGCC
GAGGGGAAGACCATCGTGTGcacgatccaccagccgtCGTCTCTGGTCTACGACATGTTCAcgaacgtcgtggtgctgtcgGCCGGTCAGACCGTGTACT
GCGGCTCCCGTCGCCAGATGATCCCGCACTTCGCGTCGGCGGGCTACGACTGTCCGCCGTACATGAACCCGGCCGAGTACTTCATCAGTCTCGTGAACAC
GGACTTCGACGACCACGCAGACGTCccgaagctggtgcagtcgtACGCGCAGAGCGAGATCCGCAAGGAGCTGAGCAACCGCATCGAGAGCGaccgcaag
acgctgcagcatctgccgGACATCGAGCAgccgtcgccgtcttcgctgcGGCAGTTCGGCGTGCTCATGTACCGCAACACGTTGAACAACATCCGCAACC
CGGGGATCTTCAA