Description :
From Genome Similarity Track
Location :
Scaffold_145:23907- 25126
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_145-fgenesh-gene-0.7RabGAP/TBC domain-containing protein

Sequence
1219 bases(100 bases per row)
GTGGCTCGGCGAGTCGGCAAAGTACGTCTGCAGGATGAAGGCGCGCGACAGCAGCGGGTCGATCTCGTCCTCCACCCAGTCCTTGGTCGGCAGGCTCTGC
AGGAACATGACGAGGTCCTGGAACTCGAGCGTCTTGAGCGTCTCGCCGAACGTCATGAGGATCGCCGCGCACACGTACACGTGGAAGCTCTCGAAGCCCG
AGTCCTCGCACAGGTACGTGTCCCACAGCCGGATGCTCGCGTGCAGCGGCACCTCGCGCATCAGCAGGCAGTTCATCCATCGGAAGGCGAACTGCACGAA
CTGCACGCTCTCCTGCTCGACAATGTGCTTAAATAGGTCGACGTCGCACCGGTGCACGAGCTCCTCCATGTGCTGCACCATGCGCTGCAGGCCTGGCTGC
GCGAACGTGTAGTGGTCCTGGATGCCGTCCAGCAGCTTCGTCAGGCACCAGTACGTGTCCGCCTCCACCACCTGTAGCAGCTCGTCCGTCACGGTCTCCA
GGTCGCACGTCTGCGGGTCGTCTGGCCATACAAAGGAGCACAAAACACCGTTATGATCCTACACATTGCCATGCTCCACACTGGTTGCAACTCGTACCGA
CATAGGTCGACAGGAAGACGACGAGGAAGGGGGTCATGAGGTCGTTGATGCCCTGCACGTAGCCGCTCGCCGGGTGCCGGATCGCCCACGTGTACAGCAC
GCGCTCCATGCACTGCAAACAGACAACGTCAGCTCGGTCAGCAAGGCAAGAATGAAATCAGTAATGTGCGTCCCCGTACCTGGTGGATGCGCTCGTTCTG
GAAGAGCTTGACGTCGGCGTTGGTGCGCGGGATGTCGACGAGGATCTGCCGCAGCGTGCCCTGCTCGCGCGCTCCCCGGTCCGTGTCGGGGATGTAGTAG
TACTGCTGCAGCAGCTCGTGGTACTCCTGCCGCTTGCGGTCGAGCATCGCGGCCCGCCGGTCCTGCTTTAGTGGCATGTACCCCTGCTCTCGCGTACACA
AAGCAATATAAGATCTCTCCATCACTACTATATGCATCAAACCGATCCGCAAACATACCAGCAGCAATCGCCAGGCCGTCGGCCGGTGCTCGGTCGGGAT
GCCTCCCCAGCTGAGCTTCCGGAGCTGTTCGAGGTCCACGACGTCGAGCCGCAACAGCTGCTCAAACTGCTCGTATCGCAGGTTGCCCGACGCGTTGCGG
GACGTCGACGCGGACGCCG