Description :
From Genome Similarity Track
Location :
Scaffold_1159:2390- 3410
Transcript NameFunction/comments
g12888.t1hypothetical protein

Sequence
1020 bases(100 bases per row)
GAGACAATCGACGCATGCCTGAAGTCATCCGAACGGTGGCCACTTTTCCAGAAGGTGCGTCTGACAGAGAACATGCGTGTTCGCACGGCTGCCACGTCCG
ATAGTGCTGCAGAAATGGCTGCGTTTTCCGAGTACCTGTTGAAGGTTGGAGAGGGGAGACACGAGGTACACAATGATCTGGGAAATGACTACATCAAGAT
TCCACGTGACATGCTCATCGACAACCCGTCGGTGATCCAGATGATGACGAGAAGATCCGACCGGGAGCTATTCCGCGAGGTATGCGGCGCATGATCGACG
AGATGTACGCCGACATCAACAATTCGGAAGTCGCAACGGACGAGTACTTTGCGAGTCGCACCATCCTCACCACCACGAACGCGATAGTCCATCGTATCAA
CGAAGCCGTAGCGGATCGCATGACTGGACCAGCTCGAGAATATGTGTCCACGGACTCAGTGGAGGATGACGAGGACGGGAACTTATTCGAGCAGGAGGTG
CTCAACTCCCTGAACATCAGTGGCATCCCACCCCACAAGCTGAAACTCAAGAAGGGGATGCCGATCATCATGATGCGGAACTTAAATCCCGACCTGGGGT
TGTGCAACGGAACACGCCTGCGAATCGTCGAACTCAAAGATCATGTCATCCATGCCACCATCATGGCCGGCGACAGGCAAGGCCAGCATGTGTTGATCCC
GCGCATCGTGTTCATCAGCGATGGCGACATCCGCGATTTCCCATTTCGACTGAGACGCAGGCAGTTTCCTATCCAGACTGCCTTTGCCATGACGATCAAC
AAGGCGCAGGGACAAACGGTGCAGTACCTGGGACTGTACTTGGCGACTCCTTGCTTTTCCCACGGTCAGCTGTATGTGGCCATGTCAAGGGTTACGTCGA
GGTCGAGATTCAAGGCATTGGTCGAGTATCCAGAGCGGGAGGAAGAAGACGGAGTGTACACGGCGAATATAGTGTACCGACAGCTGTTCGAGAGGGCGTA
GGCAGTGACTTCGTGTGAAT