Description :
From Genome Similarity Track
Location :
Scaffold_2855:239- 2663
Sequence
2424 bases(100 bases per row)
TCTCTGTCCGTCTCGCGACGGGGACACTGGTAACTGTGTCGAAGGTCTCTGTCGACCTTGGAGTGAAGTTTGAGAACTTCGATAGCGTGGAACGCTGTTT
GGTCTTAGACCCGGATGCGAGGTATGACCTCATCCTTGGCATGGCATGGCTGGAACGCCATGAGCCATGGATCGACTGGAAGTCGAAAACGCTGGGTGCG
TCGCACCCTGCTCCTAGTGGAGCTTTAATGAGTCATGAACCCACCTCTGCTAGGAAGCAGAAGCGCTTTTGGCGCGAGCACGAGGTCGAGGCGGCCGTAG
TGCTGGACATTGGTATGTCCGAAATTGTTAGCAACGAGGTTGCTGTTTGCCCTGAGGGTTTACGTGGTGCGGCACGTTATCCGCGGAGCGGTGCAGGTCA
GGGTCAATGACCAATCTGCTGGGTCCTGGTGAGACGAGCGCGGAGTGGCGCGTAATCCACTGAGTGGTACGAATCTGGTCGATGGCCTACCGCTGCGTGA
CCGGAGGGTCGCGGTCGACTGCGAGTCGAGCATCATGGGCGTGCCCAGGGAGATGCAGGTGAAGTGACACCTAGCTCACTGTGTGAAGGTCAAGAACCTC
TTGGCTTTCAGCCGAAGTGTCTTGCGAGACACTGTATTCTCTTCGAAGGAGTGATGGTGCTGCTGCACCCGGTGGTGGTGACGGAGATGTCGCCACACCG
CCCTCATCCGGCCGGTCTAGTCGCGGGAGGGAGAGGAGAAGAAGACGCAGGGCGTCTGTGACGTCTTCGACGTCGGACGATGTGTCCAACGTGACGAGCG
GTGATGCTCCACGTGATTGCTGTGAACAGCTGTATACACTCGTGAACGGAGTGACGGGGGAGGTAGAAGGCGATATCAGCCTTGATACTCTGCCCGCTGC
AGATGCTCTGCTAGAGCTGGACGAGATGTCCATTGCCGAGTTCGGCAAAGCCTTAAAGGCAGGCGAGCTAGCCGAGGTGGTCTTGCTGGGACCTGAGGAG
GAGTTGAACTCCTCATCCGTCGTGGACGACGCGGTCCTAGAGGACACCAAGAAGGCGCTGAGCGCAAGAAGTGGATCGGCGATCCTCAAAGATCCTTCGG
ATCCCTTCTACCCGGTGGTGAAGGAATATGGAGACGTTGTCTCAAAAGACCCACCGACGGGCCTGCCTCCGGATCGAGGCGTGTGTCATGAGATTGACCT
GGTTCCTGGAACCAAATACTGCGTAACAAGGCAATGGCCATTGCCGAGAGAGCAGTGTGACGTCATTGACGCATTCTTCCGTGCGAAGCACGAGGCAGGG
ATGGTGCGTGAGAGTAAGTCTCCGCACTCGACACCCACGTTCTGTGTCAGAAAGCCGAACGGCAAGTGGCGCATTGTTCATGCTTTTAACAAGCTAAATG
CGGCCACTATCCCGGCGCAAACGCCGATTCCTCGCAAGGATGTTCTGCAGAACAACATGGTAGGCTGTACGTTGTACAGCGCGCTCGACTTGGGCGATGG
CTACTACCAATTGCTCATGAGAGCGAGCGACATTCCGCTGACAGCGGTGAGTACTCCGAGCGGTATGCTCTGGGAGTGGCTGGTGATGCCCCAGGGGCTG
TCGAACGCACCAGCAACGCTCAATCGTCTTGTGACGCAGTTGTTTAGGCCCCACCGGGCGTACGCTCAAACGTACTTTGACGATATATTCGTCCATAGTC
GTGCCGAGCACGGAAAGTCAGACGTGGGTAACCACATTGACCACTTGCGAGCGGTGCTCGAGTGCATGCGCACTAATAAGTTGTATGCCAACTTGGACAA
GTGCGTCTTTGGCGCGGAGGAGATACCTTTCCTCGGGTGCTTCATTGGGAAGCGTGGCTTACGGGCAGATCCTGCCAAAGGCAAGGCCATCGTGGACTGG
CCGGTTCCCAAGAACCAAAAAGACTTACGCAAGTGGCTAGGCTTAGCCAATTACTTGCACAAGTACAGTGCGAACTACGCGGAGATGGCTCGACCATTAT
CACATCTCCTTAAGAAGGACGCACCATGGTGCTGGAACGTCGAGCACGACGGAGCCTTTGAGGCTGTGAAGGAGAGCCTCCTCCAGGCTCCGATCCTTGC
GCTACCGGACCCGGATAGTCCGTTTAGCGTCGTCTGTGACGCCTCCGATTTTGCAATCGGTTGTGCTTTACTACAAGCAGACGCCGAAGGGCGTGAACGC
GTGATCGCGTTTGAGTCTCGCCAGCTCAAAGCTGCAGAGAAGAACTATCCGGTTCATGACAAAGAGCTACTTGCAATGAAGTATGCTCTAGTCAAATTCA
GGGTACACCTGCTAGGCTCTAAGCCTTTTGTGATCTTTACTGATCATGCGTCGATCCGCACTGCGACACAGTCGCCTCATCTCTCTCAGAGAATGGCAAG
ATGGCTTCCCTCTTCTTCGAGAAA