Description :
From Genome Similarity Track
Location :
contig_64:238972- 240138
Sequence
1166 bases(100 bases per row)
CACCATAGCACGGCGTTATTTACAAAGTCAACACTCAAAATCAAAAACCTGTCAGATGTATTACCCTTGAAAATGATACTACCTCTCAGATCTTATCAAA
AATACGTCCCAACTTCCATGTCCTCAAAGTGCAACGCGCACTGGTGATGAGGCAGTGAATGGCAAAACACTCGATTGCGCGCTGGAGTCACCAGTTCGAC
AAACAGGGGGTCTGCAGCGAGCTTGAGATACCCGGCGCGATGCTCCGTAATCGTTGTGCCGTCGGGGACGCGCAGGATACCAGGACGCTGTTGCGCGAGA
AAGCGTTTCACAGCACTCTTGTAGACAGAAAATACATTCCCTATCGGGTTCAGCATAGGGGAGTATGAGCATCTCGGCATCTTGGAATTCCTCCTCGGCG
AACACATCCTTAATGTTGGTGTGACACGGGGCATTGTCGAGCACGAGCACGACTTCATCCAGAAGGGTGGAGGTCTTGATGCGGCGCAGGAATCGTCTGA
TAAACTCGTTCGCGAGTCCAGCAGTGAACGAGCCGAACTGCGACTCTTGGTAGGCTAGGCCAGTACTTGAGATAACGGCAATAATATGAATATTTTTACC
CTTACTGGAAACACCAGTCTGTACTGCGCACTGCCCCCGCTTGCTCCAGCCACGCCCACGTGAGCACGACCAGTTAAAGTTCGTTTCATCCAAATAAAAT
ACCTTCTTGTCGTTAGCGAGAGCTGCGTAAAACTTGATCACGTACTCGTAGCGTTTCTGCTTGTTGATTGAGCTGTTGCGGTTCACAACGTCTCAGTGCA
ACGTCTTGAGAGTGAAGCTGCGGGCATCTAGAGCGCGCCGTACGGTCTCCCGGTTGATAACCACATCGAACTTCTGCTCAACAAGCTGTACCATCTGGAC
TAGCGTCAACTCTGGCGTCGTTTCGATCTTACTGAGCAGGTAATCGTGAACAACAAGTAGCTTTTTAGATGACCTGCCGCGTTGGTGTTGGTCACCACTC
CAGTCTCCAGTCTCCATGGCCCTCTTGATCTAACCCCATGCAGTACGCTCGTTGACGGTGTAGAGTTCCGCCACGGTTTTCCAGTTACCAGCATTATTTG
CCACTCGCAGGATAGCCGCACACACCTAGCTTGGGTACGTCTTGTACTTGGTAGTTGGCATGGTGC