Description :
From Genome Similarity Track
Location :
Scaffold_208:23890- 27849
Transcript NameFunction/comments
Phyra_85514Hypothetical protein

Sequence
3959 bases(100 bases per row)
ACGTTGGGCGACTGAAGCCGTGCGTGCAGCACGAGTCACCTACGTCTGGTGACTCGCCAAAGCGCTCTCGAGCGCGGCGACGCGCTTCGAGGCGGCAGAG
AGCCTCGTCCCGACCTCGACCTTCACGTTCGAGGTCGTCTGCACAACCTCCGCGAGCTGAGCCTTCAACAAGCTCAGCTCCTGACGCAGAGAAGCGAACT
GCGATGCTTGGAGACTCTCCCCTCCAAGCGAGACTCAAGGTTTGGTTGACCAAACCCGGGGCGTCTTCCCCACCCCCGTTGCGAGACGCACGCGGGGCAA
CTCGCTGGATCGTCCAGCGAATTGTTGGTCATCGGAACCAGACCCAAGGTCCGGTTCATTTTCGAATTCGTTGGAGAGGATTTCCTCCCAAACACGATAC
GTGGGAATCACGAAATGTCCTGATGAAGGACATTCCGGAAATGGTGACGGCGTACGAAGGCCGCCACCGCCATCTCCGCCGAAGGGCGTAAAACTTGAGC
GAGCGCTGTAGTCGCCTACAGCACTCGAATAAGTGCTGCGATTATCCGCAGCACTAGAAGACGCCTGCGCCTGAAAACTGGCGCGCAGGGTCTTGAGGTC
GTCAGGTACACACATGGATGTGTACCCGTTGACGTCCCGCTCGGTGATGCGTACTGCCTCGGGGTAACAGTACTCACAAGCAGTGTCGTAAGGCACTGCG
CAAGGAAGTCCAATGCCGACTGCACCATGGTGCAGTCGTTCAAGTTTACCACGCTCTGAGAACTTCTCGTAGCGCTCCTGCGCCTGGCTAATCCGATCGC
GATAGCCAGCGGGGTTCTTGTTGAAGTTTTCAACAAAGGCACTCCAACTCTGACAAAGTGCCTGCCACTCGGGCACTTTGCTTCTGCGAGAAGTCTTCTT
GCTCGCAAACCATCGGAGCTCATGGAAGAGCCCGATGTAGTAATCGCGCCTTTGATCCGTCATCGGATCAAAGTGCAATCGCTTCGCGACGTCATCGTCA
ACGATGGCGTTGCACGAGTACAGCGCGTACAGATTCGGTGGCGCGGTCGCACCGAATCGGCTGCCGATCTCAGACTGAGACGGCATCCACGGCTCGCGCA
CTGGCTCAGTGTGCGAGGTCGCAACAACAGCGGATGGAGCGGAGTCATCTCCATCCCGCGGAGTCGCTAAGGCTCCAGCGACAGCGAGCGGTGTTCCACT
GTCGCTGCGCGAACGCTTCGGGCCCGAAGCGTTCGAGTCGTTCTCGCGTGGACGACGCAGACCCACATTGGGGTCAGTGTGGCCCGGAGGCAAGGTATCC
TTGTCTCCTTCGAGTTCCCCTTCCTCGACTTCGCTTCCGTAGTCGAGGGGAACTCCCTAGTAGATACCCACTCCGGTTTCGACAGCAATGATCTTGCCTG
TCTTGTTTCGGATGGCATGTTTCTCATGCCATCTCGAGTGGTACCCAGCAACAGAGAGGCGACTCTCTGTTGCCGCGCTTGTCGCCATCGCCGTCGAGGC
GATGCCAGTAGCGGTCGTGGCTGAGGCAGCGGCCGTCGTCGCCTTGGAGGCGACGACAGCACTTGCTGTTGCCGAAGCGGCCGGCGTCTTGGACGAAGAC
GTCGTTGGCGTGCTCATTGGGAATGAGCACGTGTTCTCCCGAAGAAAATACGGATTGACGTGTCGAGACTGGCACGTCAAATCCTANNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNACAACATTAGCTGATGCCAGTGTGCAGCTACACTTCGTTAATAGATAATGCGTTATGCATGTAATCACAGTGGCTGTACAAATTCTCTCC
TACTTTATCCTTCTGTCTAGTGCAAGAGTGCATAGCGACACGTATCACCGCGAGCGGATCTTCGTACGCCAGATTAGCGTGGCATTGAATCCAGCGCTTT
AGCTATGTGGTGAAGCGGGATCGCGACATTCGCTAACGCCATCCAACTTGTGCACGGTACGCCCGGACCGCCGACTGTCGGAGGTGGTACTCCGTTGGCC
TGGCACGATCTCAACCTTTGTAGTCACCTAGACGTGACTTGGGACACCACGTTTCTATCCATAAATCATTCTACGCACTTCGCCAGAGCAACGAGAACCC
GACTTCGCTTGGATTGAGGTTGAGCGAGTATGGAGGCAGTAAAAACAGCAGCGCACCGGTTTCGCGAATCATTTCTTGAAGATCTTTGTACATGTGGATC
TTTGGATTATCCATCATCACGATCGACCGTGGCAGCGACCAGGGATTGAGGAAATGTATAATTTTGGCCTTGAATACTTCATGAAAACTAGCCCGGGTAG
AGGTACCTTCAATATTGCCCCACCCAAAAAATCCTTGAAAGTCAATCACAGCCAGCATTGAAATACGCTTTCCGCGGCTACACGTAAGCGTAACATGAAC
CGGTGTATTCCTAACTGACCAGCTATTGACGCAGCACAGATCTTCGTTACATCATTGATATTAGACCTGCCACAAAAGCGTCAACAAGAATAGACTTACC
TCCTATCTGTTTTGCTGTGTCGACAAAGACAAGCTGGTCTGGGTCACTATAAAACAATGGAAGGCGGCTGACATACTCACGCCTTTCGCAGGGGGCGCTC
TCTCTCGCACGCTTAGTGAGTACTTTTCGAGTTTGCTTTAGATTAAACCGTAGGGCCCGACAGATTGTAGAGTCGGAGACACTAATTGAGTCCTTGTAAT
GCGTTCGTAGCTCGAAACGAAGCTCTTCAAATAAAAGCACGGATGTGCTTTCACATACTGCTGCACAAGTGCACACACATTGTGAGGCCACCTTGACGTC
TTCGTGCGGGGCTCGGCCTCGAGAGCATTTCCTGTTCTCCGGAAAAGCTTGTACCATCGTGTGAGGCTGTGTTCGGAGAGTCCGAACATGTATCCGTATC
GATTGAGTACACATACATGAGCACGGTGCCTCTCCAACGAATGTTGCAATACCGAGTGCACGCCAGCCATTCGGACATTCGGTCGCATAAAGTAAGTTTT
ACAGTCCGATGAAAGGCTGTAACTCGGAGTTGCGTTCATTTTGATTGGCCGAATTGATT