Description :
From Genome Similarity Track
Location :
Scaffold_134:23888- 28346
Transcript NameFunction/comments
Phyke_g4778conserved hypothetical protein
Phyke_g4779conserved hypothetical protein

Sequence
4458 bases(100 bases per row)
CACCACACACTTGTGTTCCTCATTGTCCATTTCCCACGTAGCGACGCAGTACCGGTCGTGCATCACTGGCATTTTAGCCGCTCGTTTCTTGAGCATTCCC
TCCATCTTCACGATTTGTTGTCCTCGTGTTATTTCTACTTCTTCAgttgacgaggaggacgctTCTGAGGGTGCGACgttggagctgaagctgctggtga
tgctgtcACGAATTGTAATCTGCTGTGGCTGAAGCAATTGCgactgttgctgtagctgtcgcttctgttgttgtttttgtttgcgttgctgtttcttggc
tttTAGAAATCCGCGAATGCTGTGACTGTTGTGACTCTCCATTAGATGGAAGATGGAACGGATAATGCTGGGGGGGAGGGGGCTGGGGGGCTGAGGGGGC
TGGTGGTGACGCGGAGACGCAGTTCCGTCGATCCCCCGACCTTCGTGTCTTTGTGAGAAATGCGCTTGTCTTCGGCACCTGAGCGGGGTCAGGTACTGTC
AAGACTCGCTTAAGTTAAACATATCATGAAGTTTTCATCCAACATCAATATCTAGTCACCATAGCTATGACCTACAAGTGCATGAACATGTAGTTGCTAA
CACCGTTGGATCGACTGAAGAAAGCTATGCTTTGGGATGAACTTAGTCGGGAGAAAGCTGGCTCGAGTGTTGTGGATTGCGCCAAATAAACGCATCATTT
GCGCCTGTGTAATGTCCGCATGTTGAAGATACTGCCTGCAACGCAAGGCATGGCGACGCAAAATAACACAACCGCTCGCTGATATAAAGTCCCTTGATGT
AGGCTGCGAGGGGTCGTAGGCAATTGCGTCTGGGGTGTCGACAGCCAGCATTGAATCCCTGCGAGGGCAATCGTTTGCGTGCTTTCTGGGGGTATGATAA
GCTAATCGCGGATGCGATCGACGGTAAACCCTTGGACTGCTCGCAGCGGCAACCCACGGCTTCCTGGTATTTCGGATGTTCATATCGCACCACGATAGAT
GGTCATGTGTAATTGTGCCATTGCTCACCTCTGGCCACGGCCAATACAGTCGATACTTGGCCAGTACAAGCTTTGACGCAAGTTTCACCGACGACTAACG
ATCCTGTCAGTGCAGCTCAACAACAGGGCTGGCAGTCGTTGAACAGCAGGTGTCCCTTGTTGCATTACCACGCACTAGCAACCGGCTTCCATAGCCGTCA
CCGCACGGATCGTTTTGGCCTCGACAGGGACCTTCTCCCTATAGCAAGACTATCCATGCCTTCACACTCGACTCGACAATGCTTTCGAAAATTTTGAGGT
CCAAGGCTTGGGCCCCTTGGTACATGTGCTCGATGGCCAATTGCTCTGCCAACAATGTGTAGGATCGGATTCTAATACCGTCTAGATGCATCTTGTTAAT
GTTAACTCAGATAGATCGGAAGCAATCGATTGTGTGTGCAGTTAAATCTCGTACAACCGTACAGTGGAGCGCTGTAAGGGCATCGTTGCCGCAAAATCAG
TCTTCCCTGGTGTTGCTATCCTTCTCTTGGATCCTACTCCTGGATTCGAGTGGACTCGACTGACGCTGAGCATGCACCGCAAaagctcctcctgctctgc
AAGGCACTGGCTAATCGATCGAGAGGGCTGGAACCGATTCAGCGGTTCGTCTCGCCCCAGGTGGCGGCTCGGGCGTGGCGCACTGGACGCCATCAGGGAG
TCTCGACTTCCTCGTCTTCTGCTGTACTTACCGGGAGGCAGTACAAATCCAGTGCCAGACCGCCGAAACTCGGGTATCGGAAGCATATCCGTAGTATCAA
TCACCTCGGTGACCTCCTGCATAACTGCtggctgcatctgctcttgctgctgcttgtgtttTCGACTTTTGGAATACCGGCTGGACAACTTTCTGTGCAA
TTTCGAACGTTGAGGCTTCTCGTCAAGCAcagccacttcatcgtcgatAACATCCAACGTGGCAACGAAGGACATGTCCTCCTTTTCCAATGTGTCGTCA
GGGCGAGAGATAGAAGTCCATGAGGAATGCGACGATGACAGTGACGACGCAAGTCTTGATCGACCCGATGCGTTCAACGATGCCTTGCTGGTGTCCTCGG
ATTCCGTCTCGGACCAATCGGACTCAGACCAGTCGGATGCAGCCTCCTCCCACCAATCTCGGGAGCTGCAATCGCTTTCGCCTGACGGTGCTTTCTTCAG
TTCCCCACGCttgctgtcggtgctggCTGTGCCAGTGCTCTTGGCATGCGTATCAGCCGATGCGTCTGATGCAGTCGCTTGAGATACCTCATTTTCATGG
CGTGTTGCTGACAAACATGCTTTGCAGAAAGGTGTCTTGGCGACTTGAAAAACTCGCGATCTAGCCTCGCCGTTCCGCTCACGCGCTGCGCCACGAACAA
TCACGCAGTGGTGGCAGAAAATATCTCCGCAAAGGCGGCAATGGTAGCGATGCCGCATTGCAGCGTTGAAGGGGAGTTTGCAATTGGTGCAAGCCTTCCG
TGAGTCTTTAGGCACCCAGTTTGCTTTGCTCATCATGCCCTGCTTCGAGATCTGCTTCGACTCGACATACATGGACATGTCGTTGTGCATACGCATGATC
TTCCGGAAACTTTTGGCACTCACGGATAACCCCGCAAATTCGTTCTCGGTCATAGCGAAAAACTGCGTTGCATCTGAAGACGACCCCGCAGGACGAACGA
TGGTGACACTGTGTGTTTTGACGCGCTTCACCTTCAGGGTGCGATATAGGTCTGGGCACTCGTCGATCTCCGCCGGAAGCGTCACTCGAACGCCCACGTG
GCGACCAAGCTCGTCCTTGGTGTATGTCAAATACTCAAGGTAACACATATCACGCTTTCTACTGAAGGACGATGGTTGCAGACATGTCCACTTGATGCCC
AAGTACTCGTGGGGCTTCCCCGAGCTGCGTTTGTGGATATTTTTCAGCACCACTGCATCTACAGTGTAGCCAAACATGAACTGGTTCCACTCGAAAAGCT
GCTCAGATGTCTCGGCGTAGTGAAAATCCATGAAGTTCCTGTAATTGCCGCTAATGCGTCCGTAAAATCGGAATTCGCTGCGAGAGAGTCCTTCAGGAGA
TTCTTGTCGGATGGCAGTCAATGAGCCTTCGGTGCCAACGGAGACCCATGGACTGCCGTAGATCGGATAGGCTCCTTTGGCTTCGTGCCGCTCGTATTCG
AGCAGAGCATTCCGAACAATTATGTTCACCTGTGTCTCGTAGCTCTGAATCTGCTCGTCCGACAGCTCTACAGCAGGGAAAAAGTCATCTGGTAGTGGAA
ATGTCTTGGCGTCATTCCTGGTGATACGCCATTGAAGTGCCATGAGGCGGGACCACGCCATGCAACCATGTTAGTTATCGGAGACCATGTGATCGATCAC
GCCAAATTGCCGTTTCCAATTGCAAACGAAAACGTACCGAGACTTGGTGCGACCACGCCCAGAGAGCATGACTGAAAAATGCTAAATGAACTAATCGCGA
CCAAGGGTAGCGGAGATCccttgagctgcagttcgCTCGAGCGGTCACTTGGAGGGCTCACACACAGCACGAGAGTCGGTTGGGGACCGGTCCAGCTGGG
GACATTTCCACGCGATGTGCACGGTTTTGACCGAGCCTCCACTACTTTTCAAGAGTACTTCGTGCGTAGCCGGAGCAAGACTATCGGAAAGATGGTGTTT
CGAGCCATGCTGCCGTTCCGCCGGCAATGCTTTCGGACACAGGTCACGTGCTCCAAGGTTTGGGCATGCGTGCGAGCCTTTACCTCTGCGCGCTCGCAAC
TGACCAAACCTTTTGTTGGCAGTGCCAATTTAGCAGACAGTCGAAGATCCCAGGGATTGGGACGAAGCTTTCGAGTCAAACTTTGTCATGCTCCGATGCT
GCAATCGCGGTATTTAGAATCGTCGACAGCTGCATGCCTTTGAGGACGCTTGCAGCACGTACAAATATCGTGGCGGTCTCGTAGTGCTTTCGACGGTTTT
AGTACTCCGTGCctttgctgttgctgtcaaCGAAGCGTTGATACAGCGgcgacctgctgcagttgacTTGCTCAGCAGGTTGTTGTGCCACGCCGGTACG
TCCCACCTAAGCATACAGTGCAGCACACAAACTAGGATGGACCGTGTTTGTGCCTTCGTTTGTGGCCGAATCAAACCGCCGCCACAATATCTCGCTTACC
CCCCGTAAAAGGTTAGCCGTGAAGTAGAGGACGCCGAGCCTCGACTCAAGGATTTTCGCCAATGCGGCATGGGTCGGCATGTTCGTCAACGAGCCATTGG
CAAAGAcaagatgacgaagagggAGTCGCCAATATCATACTCACGCCTGTACAGACAGTAGTCTGTAAGGCCGAGACTGGTGGAATTGGCTCTCATGCGC
ACTGCAGTGTGCGTTGGGTCAACGCCGTTGGCAGAAGTCACCTCACAGAAGTCCCTTC