Description :
From Genome Similarity Track
Location :
contig_162:23885- 25500
Sequence
1615 bases(100 bases per row)
GGGGCTCCAAACGAGCGGCCACGGAACGGCACTTTTCTATAGCGCAGACACTGTGGACCACACTGAAACCGGTGATACAGAATGAAAGACCTGCCGTATG
GCATATCTCGTTTTTTATGCAGCAAGCTATTTTTTATTGGTGGAAAAAGGCAACTTCAAGTTGCCTTTTTAGAATTTGTGTGCCTTGCCTTGTCCGCCAA
GGCTGTTCTGGTTCTGAGGTGCAGCAGCTACAGCCCCATTCTCCTCAGGGACGGACGCCGCTGGTTCGAGTCAGAGTCGGCTGGCATGTCACCGAGCGGA
TCGATGGGGCCCGTGAGGATACGACCATCGCGTGACTGCCATTCGACATGAAAGCAAAGATGTTAGCTAACTGCAGTCGCAAAAGAAAAACTACAACAGA
AGGGGCCCACCTTGACTGCAGGGCTCTGTCGGCGAGCCAGCGGCGGGTACATTTGTGCTCGGGTGTAAGCGGATCCAGGGCGTGAGAATGACGAGATCTG
CCAGAAGCGAAGAGAAAGCAGGTGGGAACAGATTTTTGCCGTGCGCGAGGCATTTACAGACGTACCGTGTCGGCTTTTATGTCGTTTTGCTGAGTCTGCT
CAGGCTGGTCCGGGAGTTTGCGGATGATTCCTTTTGCGATCAACTCCGACTTGAGGCTCTTGTTGCAACCTTTAGCTATACAAGTTGAGCAATAGTCAGG
AGTGTGACGAGGTCTGGAGCATATTGTGACCAGTCCTACCTGAGAAGAAGGGCCAAATCGCCTCGGAGATGCTGGCGTAGTCCACCGGCCTCCGCCCCTC
CGCGTCGACCATTTTAGGATCGGCCTGGTTGTCCAGCAAGATGCGCACGACTTTCCCATGCTCTTGGAATGAGGCTGCATGCAGAGCTGTCCACCCCGTG
CCTGTCGAGGTGTTGGTGTGTTAGCCTTCTCTCGAGAATCACGTTGTTCTGTAACAAGAAGTCTGGCTTACCTTCGTTCCTGGCCGACACGTCGGCTCCT
TTGTCAAGCAAACATGTGACCATCATGTCGTTCCCCCACAGAGCTGCAGCACATAGTGGTGTCGTTCCATCTGGTGAAAAGGTTGTCAATTCCATATACC
ATGTACAACGAAACATCTCCATGCAAGTGTGGAACAAATTTGTATCAATGTGCACTCCATTGTCCAGTAGGAATTCCACCTGCGGTGAAGCAAAATCATG
TTAGAAGATTGCGCCGATGTCGAAAGCTGCAGATTCTGCCGCACACATACCATGGCACGAGAGCCGTTCGCTGCCGCCTCCGCAAGATCCACGTGCGAGC
GGATCACTCCTTCTTGGGCCTGTTGGTCGTCTCCATCCATGGTGGCGCACTAGCTGCTTGTCTTCTAGGAAGAAGCAAACTCTTCCAAAATGTTGAAACG
GATTGCGACGCTTCGAGCAAAGAGGACACCATCACAGTCAGCTCGAGGTGTATCGAATAGAGTGGCGTCAATAGATATTCAATAGGGGTCTGTGAGCCTT
TTACGACGTAGTTAGATTTTCGAGACATTTGGCAATTGACACGCGATAGACGTTTGTGCCGTGCATTGTCGTTTTGCGCCGAGATGAGTGATGAAGGTGG
CGCTCCACGAAACTC