Description :
From Genome Similarity Track
Location :
scaffold_161:23884- 25499
Transcript NameFunction/comments
g7402.t1hypothetical protein

Sequence
1615 bases(100 bases per row)
GCGATACAAGAACTGTGCGGCCGAGGGGAGGGGGGCTCCAAACGAGCGGCCACGGAACGGCACTTTTCTATAGCGCAGACACTGTGGACCACACTGAAAC
CGGTGATACAGAATGAAAGACCTGCCGTATGGCATATCTCGTTTTTTATGCAGCAAGCTATTTTTTATTGGTGGAAAAAGGCAACTTCAAGTTGCCTTTT
TAGAATTTGTGTGCCTTGCCTTGTCCGCCAAGGCTGTTCTGGTTCTGAGGTGCAGCAGCTACAGCCCCATTCTCCTCAGGGACGGACGCCGCTGGTTCGA
GTCAGAGTCGGCTGGCATGTCACCGAGCGGATCGATGGGGCCCGTGAGGATACGACCATCGCGTGACTGCCATTCGACATGAAAGCAAAGATGTTAGCTA
ACTGCAGTCGCAAAAGAAAAACTACAACAGAAGGGGCCCACCTTGACTGCAGGGCTCTGTCGGCGAGCCAGCGGCGGGTACATTTGTGCTCGGGTGTAAG
CGGATCCAGGGCGTGAGAATGACGAGATCTGCCAGAAGCGAAGAGAAAGCAGGTGGGAACAGATTTTTGCCGTGCGCGAGGCATTTACAGACGTACCGTG
TCGGCTTTTATGTCGTTTTGCTGAGTCTGCTCAGGCTGGTCCGGGAGTTTGCGGATGATTCCTTTTGCGATCAACTCCGACTTGAGGCTCTTGTTGCAAC
CTTTAGCTATACAAGTTGAGCAATAGTCAGGAGTGTGACGAGGTCTGGAGCATATTGTGACCAGTCCTGCCTGAGAAGAAGGGCCAAATCGCCTCGGAGA
TGCTGGCGTAGTCCACCGGCCTCCGCCCCTCCGCGTCGACCATTTTAGGATCGGCCTGGTTGTCCAGCAAGATGCGCACGACTTTCCCATGCTCTTGGAA
TGAGGCTGCATGCAGAGCTGTCCACCCCGTGCCTGTCGAGGTGTTGGTGTGTTAGCCTTCTCTCGAGAATCACGTTGTTCTGTAACAAGAAGTCTGGCTT
ACCTTCGTTCCTGGCCGACACGTCGGCTCCTTTGTCAAGCAAACATGTGACCATCATGTCGTTCCCCCACAGAGCTGCAGCACATAGTGGTGTCGTTCCA
TCTGGTGAAAAGGTTGTCAATTCCATATACCATGTACAACGAAACATCTCCATGCAAGTGTGGAACAAACCTTTTCCAGGTGTATCAATGTGCACTCCAT
TGTCCAGTAGGAATTCCACCTGCGGTGAAGCAAAATCATGTTAGAAGATTGCGCCGATGTCGAAAGCTGCAGATTCTGCCGCACACATACCATGGCACGA
GAGCCGTTCGCTGCCGCCTCCGCAAGATCCACGTGCGAGCGGATCACTCCTTCTTGGGCCTGTTGGTCGTCTCCATCCATGGTGGCGCACTAGCTGCTTG
TCTTCTAGGAAGAAGCAAACTCTTCCAAAATGTTGAAACGGATTGCGACGCTTCGAGCAAAGAGGACACCATCACAGTCAGCTCGAGGTGTATCGAATAG
AGTGGCGTCAATAGATATTCAATAGGGGTCTGTGAGCCTTTTACGACGTAGTTAGATTTTCGAGACATTTGGCAATTGACACGCGATAGACGTTTGTGCC
GTGCATTGTCGTTTT