Description :
From Genome Similarity Track
Location :
Scaffold_7:238741- 245489
Sequence
6748 bases(100 bases per row)
AGGAGCGGTGAGTGAAGAAGTTCTTGAATTTAGCACATGCTCTAATTTTTGTATTGTGAAGTACCATGCGTCCAATTGCTGGGTCGCTTACGCTGCTCGA
TCTGCCGTGGCGGATTTACATGAACTCACACTACAGATATTCATGCTGCATACTTGCACAGCTTCAAGCTGCCAGACTGAACTTCAGTTCATGTTGAATG
TATAATTTGTTTATTTTTCTCGGGTTATCGGGGCTATATGTCCAATTGTGACGTCTGCAACTTGATTTTGTAGAATTGCTATACTGACTTCCACGCCGTT
TAGCTCTCCTCACTTCGAAATCGACTCGCAACAAACAGTCTGCACCCACTATCATTAATCAATAGCGATAATTTTGTTTACTCAACGACGGTTTATCATT
GCTGCTGCTGTGGCATCCGACATGTACATGTAGATATCGTATCGTAGAAATGACAGTCACTTGTCTAAACTAACTTAGCCGATACGACGACGACCCTGCT
CGCTTGCTGCTCCGATACGGTCGATTCTTCGCAGATTACATTGATTGACTGATCACCCCTCTTTATTATTGCTGCTGTCTGGTTAGCTTATCGCCGAAAG
CATGCTCTGAGCTCAAATGAATCGGAGTTTGCGCTGCTATGCTGTAATATAATTGCTGTAGAACTGTCATTGCTGTTGTTTCAAATGGCTTTTTAACCGA
TAATGCAACATAAAAACTTATGTTGCATTATCTCAAACATCCGCAGGGGCGCAAACGACAGTTCTTAGAACTTGCCTGAAAAGGAAGTGCAACGAAACGA
GGCACTTGTGTAGGAGTTGTACGTTCATTCTCTCAGTGATATCTATGGATTTTAATCTGGAAGGATAGTACTAGAATATTTTTTGAAATATTCTAGTACT
ACTTCCAGATTACTTTTAGATATTTATTTTAAAAAAATAGTGAGTGGAAATACACTGTACATTGTACAGGTTACATTGATAAATACATTTTTATATTATT
CAACTACCTATGTATGCAGTGCATGAAGTCAACTTGGAGGAGATGACCAGCTTGGGAGGTGCAGTCATTTTGAGAACCGTCAAGGTTTGGCCCCCGCCTT
ACAAACACACTGCCCCCTCCCCCCGCCAGAAATTGCAAGATTGTCTACTACAATGTCAAGAGCACCCGATATTGCCTAGGAGGTCGGAATAGCATTCTCT
CGTCTAAGGCCAAGGAAGGAGTATAATGAGCTGTATGATCGCCTACAGCTGATAAAATTGTGCGCTGCACGAATCCATCTTTCGTCCCGGCCTTCTTACC
GAGTTCTCAGAACGACTAGAACGAAGAAGAAGAGTTCGATGGAGTGCGCGATACGAGCTGGTTTGCGCTAGTATAGCATTGGAACGAAACCAGATTCACT
TTACCGGGTACGCATTACGAAAACGGGTCCGGTCTGCTAAAAATTGCTCTCCGTATTGCGTAAAGATAGGATCTTATCTGTAACGGGCTAACTGCAGCCC
GTTACGTGGTTACACGAGCAGAGGAAGTAGTAGGCAAATTGAACTCTGGTATTAAGTGCCGAGACGGTCTCGGCACTCGAGACCGTCCCAGCCATTAAAC
CTATGGTGGGCTCTGATTGGCCACCGCGCACACACGGTGGCGCCTGTGTGACAGTGGCCTGTCACACCACCCCCTACTCAAGATTGGAACATACACATAT
CTAAACTCTAGAAAGGGACTGCAGAGCTTCGCGAGGCGGACGTGATGCTACTTGGCAAGCGCGGGCCGACAGCGCGCGAAGTGAGTGAAGCAGCGCAGCA
GTGTCTCGGTCGTCATCAAGGGCCGGCTGCAGCGCGACCGCAGCAGCAGCGTGGGCTTCAACGGAGCGATCTTGGTGCAGCAGAGCTATTTCATTCAGTT
TGCAGGTAAGGTATACTGTGCTCATTCAGTACTATGTTGTGTGCTAACGATCAGACGAGAGAGCTACGGAATGAAGGAGAGATGCATGGTGCGCTGGTCT
TGACGTTTTAACTTGAGGGTAAATTGCGGAAGGAGAAATACGTTAATGTGCCAAGTCCTTGGAAGTGGGCACTTCAACGCAGGTAAAGGAAGCCTAATTC
AAACGAACGATGCTCGTGTCACTGTCGAGTTGAGCTGGTTGGTTTGGCGAGAGACACGAGGTTGGGCATCTTCGGCTAAGCGATTGAGTATTGAGCAAAT
TGACATGTAAAAAATGCAGCCTGCAGCTAGACAAGTCATATTGGTCATCTTCAGCTAAGCTTGGTCGATTATGGCGCAAATTGATACGCCTTCAGCGAGG
CCATGACGCTCTCATAGTGTACTGGAGCGTCCGTAAGTGTTTGAACGCAGGTTTTTGGTCAAGAATGAACGATTAGTATCAACCTTTGGTAAATAATGTG
TATAAATTTTAACGGGTACCCGATTCCGGCAGATATTACCTTAAACATTACAATTAAGAAAGAGAGACCCGGTTTGGTACCCGGTTTTGGAAAGTTACAA
GTTTTTTGCCGGGGCCAAGCACAGGTCTTCGACTTGTGAACATTTTAAAATTCCAGCAGCGACTCTGGAGTACTGTAACACATTATTGTGTACCATGTGT
ACACATGCACATACGGTAGCAGCTGTACCTTTTAATTGTGACAAAATTTCTTGAAGCAGGTACATGTACATCTAAGGTGCATTTCACGCAATCTCTGTTG
ACTATTTTGGCTGAGCCATCTGGCGGACAATCATATGTATGTGGTTATCATCTGACCTTCAATTGACACGTACGCTGGCGTGGCATGAAGCGAGTCCGTC
GCGGTGGTACCCACCGTGACTCCACCGTGGGTCAGGTCGCCGCGAATCCTGGAACACCGAAGGTTGTCCGTCGTCTGAAGTCGAGCATCGCCGCTGGGCT
GTCCGTTCTTGCGAGGCTCTCGTTGAGTTAGGCACGACTCGCCGCCGCGCCCTCTGCAAGCGACGTCTCGTACGCCGCCACGCAATCGGGGACATCTGCG
AGTAGGACCTCGCGTGGCTCCCAGCTGTCGTCCATCGGGCCAAGCCATCGAACCAGATACCGGCGGTGCGAGGGTATCTCTCCATCGCGGCGACGAGTGC
CGCGATCCATGCGTGCGCGCTGCGGTGCATCTCGGTGGTCGTCGTGGTTGAGAATGGCTTCGACAATGTGACGCTGGTTCCCAGCAGCGTCCACTAGGGG
AGCAGGACCGTCGCGCTGGAATGCAGATGCCCGAACCTCGGGCTGACGCTGCGATGGCGCAGCGTCTTGATCGACTTGGGCATGGTCATCGGCGCCACCG
GGAATGGCGGCGGGATGGTATCGTCGCAGTCGGCCAACGTAGAACGTAGGGTGCAGCCGGAGTGCCGTATGGAGCTGCAGCGTGTAGGCGTCGCCGAGTA
CCTTCGTCACTTTAAAAGGTCCAATAAAGCGGGCGCGAGCTTGTTCGCGCCCAAGTTCGTCACCAAACTTGGCGACATGCCCGTCGTAGAGAGCAGTACC
CGATCGCCCACGGCGAACGTCTCCAGATGTCGTCGCCCTCGTCGATCGGCATATTCCTTTTGCCGGTCCACCGCCGCCGCGATGGTGTCGCGTACATAAC
GCACAACCGACTCACGTTTCTGCAGGAAGTCGCGGACAGCCGCGGCAGGTGTCGCCGCCTCTTGCGCGTCTTGATACTTGACGGCCCGACGTGGTATCGG
GTCAATCAGCGTGCGCGAAGTCCAAACTGCGATGTCCGAAGGTGCCGCCCTCCTAGCGGCACGTGTGCGCGAAGCTCGTTCGGGGTTGGCGCGTGGTCTC
TCGTGTGCCGCCCGCGTGGCGGCACGTGTGCGCACTCCGACTGCTGGAGCGTTAGAGCCTCGACGAGTGGTGACGCCATGTAACAACGCGGAGACAGCGT
CGGGTACGGGGCCACGACGCTCAGCTTGGCCTGGGTCGGGGTCTACAGCAATGTCTTCATCCGGAACGAGTGACGCGAGATCGCCCGCGTCTTCAGCAGC
GCGACCAGCCGGAGTCTCAGAGCGCTCCACACCAAGGAGCGCTGGAACGTGAGGATGGCGACCGAAGTTGACGAAGAACGGGGACAGCCCGGTCGATGCG
TGGACAGCGTTGTTGAGGGCGAATTCGACCAGGGGCAGGAAGGTGCTCCACGACTTGAACGACGTAGCGAAGCTGCGTAGTATGTCTTCAACAACACGGT
TGGCGCGCTCAGTTTGGTCGTCTGTCTCCGGATGCGACGCGGAGGACATGCACAACCGCGTCCCCAGCAACTGAAAAAGCTCTCGCCAGAAAGAAGACGT
AAAGCGAGGGTCGCGATCCGATAGGATGGAGAACGGAAGCCCGTGGTGGCGGTACACCACGTCCACGAAGATCGCGGCGGTTTGCTTCGCCGTGATGCTG
GCAGCAACAGGAGCAAGATGGAGCATCTTGCTGAACCGATCAACGAAGACAAGCACGCCAGTGCGCCCTTGAGTGTCTCGGGGAAGCCCGAAGACGAAGT
CCATGCTGACAGACGCCCATGCGTCTGTGGCGACTGGGACAGATCGAAGCGGAGCCTGCTTGGACGGATTCGGCTTCACGCGCTGGCACGCTTCGCAGGA
GCGTACTCATTTCCGGACCCACTTGTACATATGCGGCCAGTAGAAGTCTCTGGACAGCGACGCGAACGTCATCTCGCGTCCGAGGTGTCCGCCGCTCGGC
GTGTCATGGAACTCGTGGATCAGCCGAGCTCGGAGATCGTCGTCCAGAGGAACGACGATGCGCGGGGGATCTTCACAGTCGACGCGGTACGTGAGCAACG
CGCCGTCCAGCGAGTAGCGGTCGACGCGGGAGCGGCTGCGTGGAGACAGCTTGCGCTTCGCCTCGGCACCAGGGTCTCCCAGGAACTGGATCAGCTCCAA
GCAGGACGCGTCCTCCTTGTACGCGTCCACGATCAAGTCACGGAGCGGACTGGTCGCTGCAACCTCAACAGCAGCGACGTCTTCGGCAGTGCATACGGCG
CATTCGTCCTCGTTCTCGTCGCCAACTGCGTGGCGACCTGACTGCACGTAGTCAGGCCGACGCGATAACGCGTCGGCAAGGATGTTGGTCTTGCCCGGCT
TGTAGTGCACGACGAAATTGTACTCGGAGAACAGGGACAACCAGCGCGCCATGCGCTGGGACAAGTGGGGGCTCTTCGTCGCTGTCCTCAACGACGCGTG
ATCGGTGTAGATCGCGAAGGTCTGTTCGCCGAGGAGATACACGCGAAACTTGATGAGGGCGTAGCGCATGGCCAGCAGCTCCTTATCATGGACCGGATAA
TTCCCTTCCGCCGGCTTCAGCTGACGCGACTGGTAGCTGATGACCCGCTCGCGTCCTTCGTCATCGAACTGCATCAAGGCGCATCCGATCGCGAAGTCGC
TCGCGTCGCACACGACATGGAAGGGCTTCGAGTGGTCTGGAAGCATGAGCACAGGCGCGGTGGACAAGCTCGACTTCACCGCGTCGAAGGCAGCTTGGTG
CTCGGGATGCCACGACCACGTGGCGTCTGCCTTGAGGAGTTGAGATAGCGGGCGGATCGTCGAAGCGAAGTTCTTCGAGTAATGGGAAGATACGTGGCGA
GCCCCAGCCACTGCCGGAGCTGCTTCTGGTCCTGCGGCGTCGGCCACGCGCAGATTGCCTCGATCTTCTCGGGGTCGGCGCGGACACCGTCCTTGCTGAC
GTAGCTCCCGAGCACTGGGATCTCGGGAGCGCAGAAGATGCACTTCTTCAAGTTGGCGTACAGCTTGTTTTCCTTCATCACCTTGAACACCTTGCGCAGG
TGTTGTAGGAGGACCTCAACGTCCGTCATGCCGTCCTCGGCACGACTGTGAATGAAGATGTCGTCGAAGTAGCTGGGCGCGAAGTCTCGGTACGGCCGAA
GCAAGTTGGACACCATCCGGTTGAAGGTGGCGGGGGCGTTCTTGAGCCCCTGCGGCATCACGAGCCATTCCCACAACATCCCGCTGGGCGTGCTGACCGC
TGTCAGCGGCACATCGTCTTCGCGCATCAAGATCTGATAGAAGCCATCCATCAGATCAATGGCACTGTACTTCGTGCTGCCGGACATGGTGTCCAGCACC
ATGTCCTTCCTCGGGATCGGCGTTTGCGCAGGTATGGTGGCCTCGTTGAGCTTGTTGAAGGCGTGGACGATTCTCAGCCGCCGGTTGCTTTCTTCACGCA
GAACGTCGGACTGGAGTGCGGCGAGAGACTCTCGCGAACGTGGCCGGCTTGCCGGCGACTCTCGAAGAAGGCGTCAATGGCTTCGACTTGGTCGCGAGGA
AGCGGCCACTGCCGCGTCACGCAGTACTTCGCACCGGGCACGAGGTCAATCTCGTGTCGAACACCGCGGTCGGGTGGAAGAACGGCTGGAACCTTGTCCG
GGAAAATCTCCATGAACTCGCGCACGAGCGGAGCGACTGGGTTGCCGGCCGCTTCGAGCGCCGGCAACGACTGAGCTGCGTAGCGGGCTTGACGGGCGTT
CTTCGGCTCGGCTCCTTTTGGGCGCGTCCTGGCGTCGGAAGCTGGGTCCGACGCACTGGTTGCGACGGCCGCAATTGACTCGGCATCTTCGGCGACGATC
ATGCACACCTGCTCGATCTCGCCCTTCTTCAGGTCACGGAGGAAGTTTTTCCACGAGAGCCCAGGCAGCCGAGTGATCTCGGCGGCGTCGCACGGTGGAC
GTGCGACTTCGACGTTGCGTACACGCGGAGGCGCCTCCGCGTCGTCCC