Description :
From Genome Similarity Track
Location :
contig_23:238729- 239779
Transcript NameFunction/comments
g6030.t1XP_009526247.1 hypothetical protein PHYSODRAFT_501339 [Phytophthora sojae

Sequence
1050 bases(100 bases per row)
CACTGCCAACTTACGGCATGGAGTCGTCCGGACGCTTGATGATGACAGTCTTGTTCTCGAGGTAGTTGCGCAGGCCCAGCTCGCCCTGCTCGCGGCCGAT
GCCAGAATTCTTAAAGCCGCCGAACGGCGTGTTGGCCTCGATCACCGTGTAGCAGTTCACGTACACAGTGCCGGCGCGCACGCCGTTGGAGATCTTGATC
GCGTTGTCCAGGTTGGACGTCACCACGCCGGCGCCCAGGCCGAACTCCGAGTTGTTGGCGCGCTCGATGACCTCGTCAATGGTCTTAAACTTGATAATCG
ACATCACCGGGCCGAAGATCTCCTCACGGGCGATCGCCATGTCCTCCGTCACGTCGGCAAACACTGTTGGCTCGATGAAGTAGCCCTTGTCGCCCCAGCG
TTTGCCGCCGCACACGAGGCGGGCTCCTTCCTTCTTACCGGACTCGACGTAGCCCAGGATCTTGTTGAACTGCGTGCCGTCAATCTGCGGGCCGTGCTGC
GTGCTCAGGTCCAACGGGTCACCGATCTTCATGCTCCGCGCGGCCTCGCCCGAGCGGCGCACAAACTCCTCGTAGATGCCCTCTTGCACGTACACGCGGC
TGCCGGAGATGCACACCTGGCCAGCGTTCAGGAACAGACCCATCTGCGACTGCTGGATGGCCTTGTCAATGTCAGCGTCGTCGAGGATGATGTTCGCAGA
CTTGCCGCCCAGCTCAAGCGTAATGCGCTTGAGATTGTCCACGTGCGACGTGCGCATGATGGTCATGCCCGTCTCGGTGGAGCCCGTGAACGCAATCTTA
TCGACCTTGGGGTGCTGCGCAAGGTGGGCACCAACAGTGGCACCGCCGCCCGTCACGATGTTCACTACGCCCTCGGGGAAGCCAGCCTCGACAATGAGCT
CCGCAACGCGCAGAGCAGTCAGCGACGTCTGCTCAGCGGGCTTGAGCACGACCGTGTTGCCCGTAGCAAGGGCCGGGCCCAGCTTCCAGGACATCATGAT
CATGGGGAAGTTCCACGGGATAATCTGGCCGCACACACCCACGGGCTCTT