Description :
From Genome Similarity Track
Location :
contig_162:23871- 25486
Transcript NameFunction/comments
g14481.t1hypothetical protein

Sequence
1615 bases(100 bases per row)
GGCCGAGGGGAGGGGGGCTCCAAACGAGCGGCCACGGAACGGCACTTTTCTATAGCGCAGACACTGTGGACCACACTGAAACCGGTGATACAGAATGAAA
GACCTGCCGTATGGCATATCTCGTTTTTTATGCAGCAAGCTATTTTTTATTGGTGGAAAAAGGCAACTTCAAGTTGCCTTTTTAGAATTTGTGTGCCTTG
CCTTGTCCGCCAAGGCTGTTCTGGTTCTGAGGTGCAGCAGCTACAGCCCCATTCTCCTCAGGGACGGACGCCGCTGGTTCGAGTCAGAGTCGGCTGGCAT
GTCACCGAGCGGATCGATGGGGCCCGTGAGGATACGACCATCGCGTGACTGCCATTCGACATGAAAGCATAGATGTTAGCTAACTGCAGTCGCAAAAGAA
AAACTACAACAGAAGGGGCCCACCTTGACTGCAGGGCTCTGTCGGCGAGCCAGCGGCGGGTACATTTGTGCTCGGGTGTAAGCGGATCCAGGGCGTGAGA
ATGACGAGATCTGCCAGAAGCGAAGAGAAAGCAGGTGGGAACAGATTTTTGCCGTGCGCGAGGCATTTACAGACGTACCGTGTCGGCTTTTATGTCGTTT
TGCTGAGTCTGCTCAGGCTGGTCCGGGAGTTTGCGGATGATTCCTTTTGCGATCAACTCCGACTTGAGGCTCTTGTTGCAACCTTTAGCTATACAAGTTG
AGCAATAGTCAGGAGTGTGACGAGGTCTGGAGCATATTGTGACCAGTCCTGCCTGAGAAGAAGGGCCAAATCGCCTCGGAGATGCTGGCGTAGTCCACCG
GCCTCCGCCCCTCCGCGTCGACCATTTTAGGATCGGCCTGGTTGTCCAGCAAGATGCGCACGACTTTCCCATGCTCTTGGAATGAGGCTGCATGCAGAGC
TGTCCACCCCGTGCCTGTCGAGGTGTTGGTGTGTTAGCCTTCTCTCGAGAATCACGTTGTTCTGTAACAAGAAGTCTGGCTTACCTTCGTTCCTGGCCGA
CACGTCGGCTCCTTTGTCAAGCAAACATGTGACCATCATGTCGTTCCCCCACAGAGCTGCAGCACATAGTGGTGTCGTTCCATCTGGTGAAAAGGTTGTC
AATTCCATATACCATGTACAACGAAACATCTCCATGCAAGTGTGGAACAAATTTGTATCAATGTGCACTCCATTGTCCAGTAGGAATTCCACCTGCGGTG
AAGCAAAATCATGTTAGAAGATTGCGCCGATGTCGAAAGCTGCAGATTCTGCCGCACACATACCATGGCACGAGAGCCGTTCGCTGCCGCCTCCGCAAGA
TCCACGTGCGAGCGGATCACTCCTTCTTGGGCCTGTTGGTCGTCTCCATCCATGGTGGCGCACTAGCTGCTTGTCTTCTAGGAAGAAGCAAACTCTTCCA
AAATGTTGAAACGGATTGCGACGCTTCGAGCAAAGAGGACACCATCACAGTCAGCTCGAGGTGTATCGAATAGAGTGGCGTCAATAGATATTCAATAGGG
GTCTGTGAGCCTTTTACGACGTAGTTAGATTTTCGAGACATTTGGCAATTGACACGCGATAGACGTTTGTGCCGTGCATTGTCGTTTTGCGCCGAGATGA
GTGATGAAGGTGGCG