Description :
From Genome Similarity Track
Location :
Scaffold_318:2387- 4945
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap_masked-pug3_contig_318-abinit-gene-0.27P-type ATPase (P-ATPase) Superfamily

Sequence
2558 bases(100 bases per row)
ATGATGGGGAGTGCTGTGAAAATGAGATTGTACCCTTGCTGGATGAACGCCGAATAGAGCATCGTCCCCGAGTACGCTGTCGCGAGCATCGCATACCAAA
ACATCGATACACAGTATACGACATTCTTGTAAAAAGTATACACCGTCAACGCAGCCACGCGATCATAGTTCCAACGCCCATGCACGAGAAGCAAGGGGCT
CAAAAAGCGAAATTGCCCCAGGGCATAATCGGAGCTATTTACTGCTTGCATTCCTTCTTGGCCACTGATACCAACGCCGATGTGCGCACTTTGAATCATT
GGGACGTCGTTTGCGCCGTCACCAATAGACAAGGTATGCGAGTCGTGAACATTCAACTTCACCAACTCGACCAATTGCGCTTTCTGTTGCGGTGAAACGC
GACAGGCGACAACGACTTTGCAGAGCAGCGACACTCGAAGCAAATGGAGGTTGTACAGCGGGTCTTCGAGAATCAAATTCAAGCAACCACCATCAATGAC
AAGCGCATGTTCAACATGCTTTTTCATTGGAGTCCCCATCGATGGATATGTTGGAGTTGCACCATTAGTCTCATTGCTTTCGTCACCGTTGTCGACGTCG
TAAATGGAATGAAACACCTTATCCAGCTGCCGCAAAATGGATCCTTTGGTACGATACGTCGCTGAGTTGATGACATGGCGCTGCATATCATTGTTCAGCA
AACGGCACGCGTAGCCAATGTTAATGGCAGTTTCTTCCATGTCGCCAGTCAACACCCAAATGTTGATGCCGGCCTTTGCCAATTGTTCCATGGTTTCTGG
GACTCCATCTTGCAGGCGGTCTTCAATGGCGGTTGCCCCCAACAGGTCAAAACCAGATTCCAGTTCGTCTTGCAAAAGATCAATCGCATTTTTATCACCA
CGAGCTTTCGCTTCAACTTCCTGCAAGTCGGCCAAAGCGCGGCGGTAACCCTCGTGGAAAGATTCCCAATCCTTCATTGACATCTTCTTGGAACAAATCA
CCAGAGTACGCAACCCATCTTGTGCAAACGTTTCCAGGTCCGCTAAAGTTTTCTGCCGCGTTTTCGCATTCGTTTTGGACACGGAATCCGGGGCAAGGCG
AGGAAACAAGACGCTGTCGGCACCTTTTGTCAACACGAGCACTTCATCTTCATCATTTTCCGTCATCTGCATCAGTTCTTCGTCTGTCTTCCTGCGCTGA
ACGATCACTGTCATACGTTTCCGTGTCGAGTCAAATTCAAACACTTCAAGAACATCGTACTTGTCAATTTTTCCGTTCGGCCGCTTCAGAGATACGCTGC
CAGGCTCACGGTCAATAAACTCGTAACCAAAGTACTTGGCACCGCAAACAAGTGCTTGCTCGTCTGGTGAGGACGCTGAATACTGGATAGGAAGCTCTTC
CATGCCTTCAGGCACCGTATCAATTCGTTCAATGAGGACTCCGTGACACAATGCCAAATGCGTGAAAAATTCCTTGATTTTTTCACTTTGCTCCTCTCCT
TCTTGAGCCAGGTGCTGCCAAATTCGACGGTCCTTGAAGTTCACATTTGGGGCAGGACACTTCACGAATTCATCATCCTCGTTCTCCGACTCGTCATCCA
CATTTCTGTTGCCTTGAAAATCATCTCGGAGCCGCGCTGCTAAGCCAATTGCTGTAATACCTTTCCCGTAGCTTTGACCGTTGATACTGCACTTGCGAAA
CTCCATTTTGTTGCAGGTCAGCGTTCCGGTTTTATCCGAAAAGATGTGCGAAATCTGACCAAGTTGTTCATTCAACTGCATGTTTCGTGCCACCATCGGG
ATATCGTTTTCTTCATCGTACATATCCAGGTCGCGTTCCATAAAGTACGCTTGTAGCGCCTTCACCAACGTGATAGACACGTAGAGCGTGATCGGAACCA
TAGATGCGAGCGTCGTGAAATAGTAGACAAACGTCCCCAAGATACTTTTGCTGAGGTCACTATCAATGTATGAAGGAATCGTCTGGTCATGCATCCAAAT
GTTGTCGCTGATTGCGCCAATCAATGACATGAGCATCAGGAGCAGCACGACAATGATGACTTGTTTGTTGGTCATTTCATCGATCGACGACACCTTGACT
GGGAACTCATCTCCGGAACTCATCATAATCTTCGTATCGACGCCAGTGTTGACAACTAACCCGTACACGAAACTCGTATTGCGCAATTTACTTCCACGAA
GGAGCATATTCTTCAGCGAAAGTGCAATCCCCACATCGGCATTGGAGTCAGTGTCATCCAAATACAGCGTTCCAGAATATCGGTTGATGTCACCGTTCGG
GAGTTCACTTTCCACATATCCTTGCATCACTTCGCCAGCATCTTCTTCGTTCACAAACATGCTCCGCGTGGCTTGGGGCGCTTCTCGTAACTTCAAGTTG
GTCTCTCCATCCAAATTTTTCGTTTCGACGTAGCAGACACCGGTGTTACCTCCGCTTCGTGCACCTTCAGCAGGCACGACGGAAAGAATGAGAACGTCGG
CAGGTAGCGTCTCATGGTTCTTGATCTTGACAAAGTCGCCGACTTTGACATCGCGCCA