Description :
From Genome Similarity Track
Location :
Scaffold_3:2386600- 2393610
Sequence
7010 bases(100 bases per row)
GTCTAAGTAGTCATGACAGAGAAGACCTCTGTGAGGTGACGGCGATAGATTCGAAGCGTTGTGCTCTCTCCTCAGCGTGTTGCCGCTCTCTCACTTTTCA
TTTCGCCTTCTTCTTTGCACTCTTGACCACCGCCCTACCAGCACCACCGTCAAACAACCAAGAAACATCGCGTTCAAGATGCATTCCAAGATCATCCTGT
TGCTCGGTGTTTGCGTCGCTGCCTCCATACTGCAGACGGCTGACGCACGCACTACCGGGCGCAACCCTCGTAAGCACGATCATGGGCATAGGCAGCACCA
ACATTGCTTCCGCAGGTGGCAGCAGAGGCCAGAGAGACGAGCGCCCTAGCTGCAGAAGGAGTAGCCGCGATGGTCCATGATGTTGGGGAGATTCAGAAAT
GGTTTGTGTGCCCCAGGACAATAAGTAAAGCCAATGTGAGTTTTAAGTAACTCTTACGTAAATTTACGTAGAAAGTCCGGAAAAAGTTATTATTTGAGGT
TTAGGACAATCTGGAGGACACAAATTATAATATTCTGTAACGAAGGATTAGTCGCTTTTTAGGACACATCTCCAAAATCTCCCTGTAAAATTTAGGACAA
ATAGGACAGTTTAGGACGTGTCTTAGGACGCATTATCCTACACCAGCACCACGGCCACGACCACCACAAAGACCATTCGCACTATAGTCGCCGCTTAGAA
GACAAGGACAACAAGGACGACAAGGTCACGGAGTCATCCAAGTACACCAGTAGCTACGGCAAATACGATTATGGCCGCGACGACTATGGCCACGACGACT
ATGGCGACTACGACTATGGTCACGACGATTATGGTCACGATGACTACAAACGGAAGGGCTACGGCTACGACGACCATGACTACAAGGGCTATGGCGTTGG
CTACAGCTAGGGCTACAAGAGCTATGGCAAGGACTACGATGACTACAACGACGACTACTACGGCCATGGCAAAAACTACTACAGCTATGACAAGGGATAC
GGCAAGAAGGACTACGACTACTACCCTGACTACTACTCGTCGTACAGCGGTGGCTATGGTTATGATGGCTACTATAACAACGGATACTATCCCGATTCCT
ACTCGTCCTATGGCTACGGTGACAAAAATGGCTATGGATACTACCCAGATTACTACTCGGCCTATGGCTACCCTAGCTACGGTTACGGCTACAGCCACGG
CAACAGCTACGGCTATGGCAACCCCTCCTACGGTTTCGGATCCCCGGGATTCTTCGACTACGAGTCTGCTGCATCGGACGCTGGCACGGACAGCACTCCG
AAGGAGCAGGGTTCGGACGCGGCCAAGAGTAAGTCGGAGAAGAAGGAAGACAAGCCCAACGTTGAGAAGAAGGAAAACAAGTCGAATGCCGCGAACAAGT
CGAAGGGCAAATGAAGACGTGATCATAGAAACATGAAGCGTGTGCAATACGTAGCGTTGGAAAGCAGAGGTAACAGTAGAAAATACAATGCCAATTAATG
TGACGTGGTAAATAGTTAGAGCTTAGTTCGGACTCGTCCCTGGAACACCAAACTCGTCCCTGGAACACCGAAACCAGTCCGTAAGAAAAGAGCTATAGTA
ATAAGCGCCGTTGCAAGGACCATTTTATGGACCGGGATGCCCCTCTAGTTGATATGGTTAGTACTTGATATGTTCTACGTCGAAGGCTTGATCTGTGTGC
ATTTCTATTATTTCATGGTCGTACAAATGGATTAAGTATTGCGTTCGTTGAGGAAACGCGGACTCCTGTAAGATTTAATAACGTCTTTTGTTTTTTTTAT
CCAAGTATCCAAATCCGAAGGTTCAGGATCCCGCTTATGATGAGCGTTGGATATTCATTCTCTAATTTGATACGAAGGCGTAGATTGGATAATCCACAAA
AACTGAAAAAGCGTCACCAAAATTGAACCTTAACCGTTACTTAGTACTGTAAACAACAACTGTGAGTCACAAAGTTATGATAGAATGAAGTTGCGAGAAT
CGTGTTGAATGCCTCAGTCTAAGTAGTCATGACAGAGAAGACCTCTTTGAGGTGACGGCGATAGATCCGAAGCGTTGTGCTCTCTCTTCAGCGTGTTGCC
GCTCTCTCACTTTTCATTTCGTCTTCTTCTTTGCACTCTTGACCACCGCCCTACCAGCACCACCGTCAAACAACCAAGAAACATCGCGTTCAAGATGCAT
TCCAAGATCATCCTGTTGCTCGGTGTTTGCGTCGCTGCCTCCATACTGCAGACGGATGACGCACGCACTACCGGGCGCAACCCTCGTAAGCACGATCATG
GGCATAGGCAGCATCACGGCCACGACCACCACAAAGACCATTCGCACTATAGTCGCCGCTTAGAAGACAAGGACAGCAAGGACGACAAGGACGACAAGGT
CACGGAGTCATCCGAGTACACCAGTAGCTACGGCAAATACGATTATGGCCGCGACGACTATGGCCACGACGACTATGGCCACGACGATTATGGTCACGAT
GACTATGGTCACGACGACTACAAACGGAAGGGCCACGGCTACGACGACCATGACTACAAGGGCTATGGCGTTGGCTACAGCTAGGGCTACAAGAGCTATG
GCAAGGACTACGATGACTACAACGACGACTACTACGGCCACGGCAAAGACTACTACAGCTATGACAAGGGATACGGCAAGAAGGGCTACGACTACTACCC
TGACTACTACTCGTCGTACAGCGGTGGCTATGGTTATGATGGCTACTATAACAACGGATACTATCCCGATTCCTACTCGTCCTATGGCTACGGTGACAAA
AATGGCTATGGATACTACCCAGATTACTACTCGGCCTATGGCTACCCTAGCTACGGTTACGGCTACAGCCACGGCAACAGCTACGGCTATGGCAACCCCT
CCTACGGTTTCGGATCCCCGGGATTCTTCGACTACGAGTCTGCTGCATCGGACGCTGGCACGGACAGCACTCCGAAGGAGCAGGGTTCGGACGCGGCCAA
GAGTAAGTCCGAGAAGAAGGAAGACAAGCCCAACGTTGAGAAGAAGGAAAACAAGTCGAATGCCGCGAACAAGTCGAAGGGCAAATGAAGACGTGATCAT
AGAAACATGAAGCGTGTGCAATACGTAGCGTTGGAAAGCAGAGGTAACAGTAGAGAATACAATGCCAATTAATGTGACGTGGTAAATAGTTAGAGCTTAG
TTCGGACTCGTCCCTGGAACACCAAACTCGTCCCTGGAACACCGAAACCAGTCCGTAAGAAAAGAGCTATAGTAATAAGCGCCGTTGCAAGGACCATTTT
ATGGACCGGGATGCCCCTCTAGTTGATATGGTTAGTACTTGATATGTTCTACGTCGAAGGCTTGATTTGTGTGCATTTCTATTATTTCATGGTGCGTACA
AATGGATTAAGTATTGCGTTCGGTTGAGGAAACGCGGACTCCTGTAAGATTTAATGACGTCTTTTGTTTTTTTTATCCAAGTATCCAAATCCGAAGGTTC
AGGATCCCGCTTATGATGAGCGTTGGATATTCATTCTCTAATTTGATACGAAGGCGTAGATTGGATAATCCACAAAAACTGAAAAAGCGTCACCAAAATT
GAACCTTAACCGTTACTTAGTACTGTAAACAACAACTGTAAGTCACAAAGTTATGATAGAATGAAGTTGCGAGAATCGTGTTGAATGCCTCAGTCTAAGT
AGTCATGACAGAGAAGACCTCTTTGAGGTGACGGCGATAGATCCGAAGCGTTGTGCTCTCTCTTCAGCGTGTTGCCGCTCTCTCACTTTTCCTTTCGCCT
TCTTCTTTGCACTCTTGACCACCGCCCTACCAGCACCACCGTCAAACAACCAAGAAACATCGCGTTCAAGATGCATTCCAAGATCATCCTGTTGCTCGGT
GTTTGCGTCGCTGCCTCCATACTGCAGACGGCTGACGCGCGCACTACCGGGCGCCACCCTCGTAAGCACGATCATGGGCATAGGCAGCACCACGGCCACG
ACCACCACAAAGACCATTCGCACTATAGTCGCCGCTTAGAAGACAAGGACAACAAGGACGACAAGGTCACGGAGTCATCCAAGTACAGCAGTAGCTACGG
CAAATACGATTATGGCCGCGACGACTATGGCCACGACGACTATGGCCACGACGATTATGGTCACGATGACTATGGTCACGACGACTACAAACGGAAGGGC
CACGGCTACGACGACCATGACTACAAGGGCTATGGCGTTGGCTACAGCTAGGGCTACAAGAGCTATGGCAAGGACTACGATGACTACAACGACGACTACT
ACGGCCATGGCAAAAACTACTACAGCTATGACAAGGGATACGGCAAGAAGGACTACGACTACTACCCTGACTACTACTCGTCGTACAGCGGTGGCCATGG
TTATGATGGCTACTATAACAACGGATACTATCCCGATTCCTACTCGTCCTATGGCTACGGTGACAAAAATGGCTATGGATACTACCCAGATTACTACTCG
GCCTATGGCTACCCTAGCTACGGTTACGGCTACAGCCACGGCAACAGCTACGGCTATGGCAACCCCTCCTACGGTTTCGGATCCCCGGGATTCTTCGACT
ACGAGTCTGCTGCATCGGACGCTGGCACGGACAGCACTCCGAAGGAGCAGGGTTCGGACGCGGCCAAGAGTAAGTCGGAGAAGAAGGAAGACAAGCCCAA
CGTTGAGAAGAAGGAAAACAAGTCGAATGCCGTGAACAAGTCGAAGGGCAAATGAAGACGTGATCAGAGAAACATGAAGCGTGTGCAATACGTAGCGTTG
GAAAGCAGAGGTAACAGTAGAAAATACAATGCCAATTAATGTGACGTGGTAAATAGTTAGAGCTTAGTTCGGACTCGTCCCTGGAACACCAAACTCGTCC
CTGGAACACCGAAACCAGTCCGTAAGAAAAGAGCTATAGTAATAAGCGCCGTTGCAAGGACCATTTTATGGACCGGGATGCCCCTCTAGTTGATATGGTT
AGTACTTGATATGTTCTACGTCGAAGGCTTGATCTGTGTGCATTTCTATTATTTCATGGTGCGTACAAATGGATTAAGTATTGCGTTCGTTGAGGAAACG
CGGACTCCTGTAAGATTTAATAACGTCTTTTGTTTTTTTTATCCAAGTATCCAAATCCGAAGGTTCAGGATCCCGCTTATGATGAGCGTTGGATATTCAT
TCTCTAATTTGATACGAAGGCGTAGATTGGATAATCCACAAAAACTGAAAAAGCGTCACCAAAATTGAACCTTAACCGTTACTTAGTACTGTAAACAACA
ACTGTAAGTCACAAAGTTATGATAGAATGAAGTTGCGAGAATCGTGTTGAATGCCTCAGTCTAAGTAGTCATGACAGAGAAGACCTCTTTGAGGTGACGG
CGATAGATCCGAAGCGTTGTGCTCTCTCTTCAGCGTGTTGCCGCTCTCTCACTTTTCATTTCGCCTTCTTCTTTGCACTCTTGACCACCGCCCTACCAGC
ACCACCGTCAAACAACCAAGAAACATCGCGTTCAAGATGCATTCCAAGATCATCCTGTTGCTCGGTGTTTGCGTCTCTGCCTCCATACTGCAGACGGCTG
ACGCGCGCACTACCGGGCGCCACCCTCGTAAGCACGATCATGGGCATAGGCAGCACCACGGCCACGACCACCACAAAGACCATTCGCACTATAGTCGCCG
CTTAGAAGACAAGGACAATAAGGACGACAAGGACGACAAGGTCACGGAGTCATTCAAGTACAGCAGTAGCTACGGCAAATACGATTATGGCCGCGACGAC
TATGGCCACGACGACTATGGCCACGACGATTATGGTCACGATGACTATGGTCACGACGACTACAAACGGAAGGGCCACGGCTACGACGACCATGACTACA
AGGGCTATGGCGTTGGCTACAGCTAGGGCTACAAGAGCTATGGCAAGGACTACGATGACTACAACGACGACTACTACGGCCACGGCAAAAACTACTACAG
CTATGACAAGGGATACGGCAAGAAGGACTACGACTACTACCCTGACTACTACTCGTCGTACAGCGGTGGCTATGGTTATGATGGCTACTATAACAACGGA
TACTATCCCGATTCCTACTCGTCCCATGGCTACGGTGACAAAAATGGCTATGGATACTACCCAGATTACTACTCGGCCTATGGCTACCCTAGCTATGGTT
ACGGCTACGATCACGGCAACAGCTACGGCTATGGCAACCCCTCCTACGGTTTCGGATCCCCGGGATTCTTCGACTACGAGTCTGCTGCATCGGACGCTGG
CACGGACAGCACTCCGAAGGAGCAGGGTTCGGACGCGGCCAAGAGTAAGTCGGAGAAGAAGGAAGACAAGCCCAACGTTGAGAAGAAGGAAAACAAGTCG
AATGCCGTGAACAAGTCGAAGGGCAAATGAAGACGTGATCATAGAAACATGAAGCGTGTGCAATACGTAGCGTTGGAAAGCAGAGGTAACAGTAGAGAAT
ACAATGCCAATTAATGTGACGTGGTAAATAGTTAGAGCTTAGTTCGGACTCGTCCCTGGAACACCAAACTCGTCCCTGGAACACCGAAACCAGTCCGTAA
GAAAAGAGCTATAGTAATAAGCGCCGTTGCAAGGACCATTTTATGGACCGGGATGCCCCTCTAGTTGATATGGTTAGTACTTGATATGTTCTACGTCGAA
GGCTTGATTTGTGTGCATTTCTATTATTTCATGGTGCGTACAAATGGATTAAGTATTGCGTTCGGTTGAGGAAACGCGGACTCCTGTAAGATTTAATGAC
GTCTTTTGTTTTTTTTATCCAAGTATCCAAATCCGAAGGTTCAGGATCCCGCTTATGATGAGCGTTGGATATTCATTCTCTAATTTGATACGAAGGCGTA
GATTGGATAATCCACAAAAACTGAAAAAGCGTCACCAAAATTGAACCTTAACCGTTACTTAGTACTGTAAACAACAACTGTGAGTCACAAAGTTATGATA
GAATGAAGTT