Description :
From Genome Similarity Track
Location :
contig_48:238557- 239734
Transcript NameFunction/comments
g10293.t1XP_009518265.1 hypothetical protein PHYSODRAFT_555724 [Phytophthora sojae

Sequence
1177 bases(100 bases per row)
GCTCGCGAGGTGCTCCTTTGAGAACTCCACAAGCGGTGGAGTAAAAGTCTCCGGACCTACTTTGCTTCCCGTCACATCCGAACGAATGACGGCTGCCACA
ATCTGTCCCCAGGTTTCGTCAGGAAGTCCAAAGACTGCACACTCGAGCACCTGCGGGTGGGTCAACAGCACCCGCTCGACGTCCAGAGCCGACACCTTGT
AGCCTGCAGTCTTGAGAATGTCAGCACTCGCTCGTCCACGGATGCGGAAGCTCTGAAGTTCGTTGCTGTACTGCACAATGTCGCCGGTCTTGAACCACCC
GTCCGCGTCGAACTCCTTGGCCGTAGCCTCGGGCTTGTTCCAGTACTCGCGGAAGACGGACGGCCCCTTGACGCGCAGCTCGCCTTCCTTCTCTTCATGG
AGCGGCAGCTCAGTCTCCGTGTCGGGGTCCACTACGCGTACCGACACACTCGGGAAGGTGTTGCCCACGTATCCAAGATGACGGTCCCCATGCAGCGGGT
TCGTGAGCACCATGCCAAGCTCCGTCATACCGTAGCGCTCAAGCAGACGCAGTCCAGTCAAGCTCTCCCAGCGGCTCAAGATGGACACGGGGCATGCCAT
CGATCCACTGATGGCCACGCGCAGTCCTCGAGCACCTTCGAACACCTTGGGATCTTGTTGCGGCTGCTTCTCCATGACTTCCAGCAGCTTCATGTACACG
GTTGGCACCGCCATGAGCATGGACACTGGGCGCTTTGTGCCTGCAGCTTCGCCCAGCTTGGACCAAATAACGGGTGGCTTGGCAGATGGCAGGAACTCCA
CAGACCCACCCACGTACATGACACAGAGCAAGTTGTTCAGAATGCCGTGCACATGGTGCAACGGCAAGAAGTGCAGCAAATGGTCATGGCTGGACATCTC
CCACGCCGTCACTAGATCACTGATTGCGCCGTGAGGGCAGCGTGCGTGGTCACTACGCCCTTAGGACGCCCCGTAGTGCCACTGGTGTAGATCATGTAGG
CTCCAGCCTTGCTGTAGTCTCTGGTCTCCAGCCACTGCTTCACCTCCTTCTGCTGCTCAGCCGTCAGCTCCGTATCATTACCACCCTCGACATCATCTGG
ACGCACGATCACCTGCACGTTCAGCCTCGTCGGGAGGCCAGCAATGTACTCCTCGAGCGTGGAGCCCGGTGCCGTGA