Description :
From Genome Similarity Track
Location :
contig_48:238552- 239729
Transcript NameFunction/comments
g9833.t1XP_009518265.1 hypothetical protein PHYSODRAFT_555724 [Phytophthora sojae

Sequence
1177 bases(100 bases per row)
CTCCACAAAGAAGTACTTTCGCGGCACGCGGTAGCTCGCGAGGTGCTCCTTTGAGAACTCCACAAGCGGTGGAGTAAAAGTCTCCGGACCTACTTTGCTT
CCCGTCACATCCGAACGAATGACGGCTGCCACAATCTGTCCCCAGGTTTCGTCAGGAAGTCCGAAGACTGCACACTCGAGCACCTGCGGGTGGGTCAACA
GCACCCGCTCGACGTCCAGAGCCGACACCTTGTAGCCTGCAGTCTTGAGAATGTCAGCACTCGCTCGTCCACGGATGCGGAAGCTCTGAAGTTCGTTGCT
GTACTGCACAATGTCGCCGGTCTTGAACCACCCGTCCGCGTCGAACTCCTTGGCCGTAACCTCGGGCTTGTTCCAGTACTCACGGAAGACGGACGGCCCC
TTGACGCGCAGCTCGCCTTCCTTCTCTTCATGGAGCGGCAGCTCAGTCTCCGTGTCGGGGTCCACTACGCGTACCGACACACTCGGGAAGGTGTTGCCCA
CGTATCCAAGATGACGGTCCCCATGCAGCGGGTTCGTGAGCACCATGCCAAGCTCCGTCATACCGTAGCGCTCAAGTAGACGCAGTCCAGTCAAGCTCTC
CCAGCGGCTCAAGATGGACACGGGGCATGCCATCGATCCACTGATGGCCACGCGCAGTCCTCGAGCACCTTCGAACACCTTGGGATCTTGTTGCGGCTGC
TTCTCCATGACTTCCAACAGCTTCATGTACACGGTTGGCACCGCCATGAGCATGGACACTGGGCGCTTTGTGCCTGCAGCTTCGCCCAGCTTGGACCAAA
TAACGGGTGGCTTGGCAGATGGCAGGAACTCCACAGACCCACCCACGTACATGACACAGAGCAAGTTGTTCAGAATGCCATGCACATGGTGCAACGGCAA
GAAGTGCAGCAAATGGTCATGGCTGGACATCTCCCACGCCGTCACTAGATCACTGATTGCGCCGTGAGGGCAGCGTGCGTGGTCACTACGCCCTTAGGAC
GCCCCGTAGTGCCGCTGGTGTAGATCATGTAGGCTCCAGCCTTGCTGTAGTCTCTGGTCTCCAGCCACTGCTTCACCTCCTTCTGCTGCTCAGCCGTCAG
CTCCGTATCATTACCACCCTCGACATCATCTGGACGCACGATCACCTGCACGTTCAGCCTCGTCGGGAGGCCAGCAA