Description :
From Genome Similarity Track
Location :
Scaffold_1606:2385- 3703
Sequence
1318 bases(100 bases per row)
CTTAGGATTTGTACGCAGGCCAAATCTGTACCAACCTATAAATACATTCAGTCTTAGATCTACCGCTTTCNAAGTCAAGTCGTCCCCTACAGACCAGGGA
CACGTGAACGGCTGTTCACTTGGAGTTTGTATACTCCTGCTTCCTCTGTTAAGAAGTGCTGTGTGCCCCGTCACACTTGGTAGCACTTGTAGTCAATCCT
ACGCCTACGCGGGTAGATTGGACTACCTGAATCCTCTGTGGTCTCATCGAGTGAGCCAAGATGGATCGTACGGAGTTTCCCCATCTGAACGACTCGCAGT
ACGAGTCCGTTCGTAAGATGGCAGGCATCTTTGGGACAGATGCCCTGCGTAGCTTAGCGGCGGCGACGCCGGCTGAGCAGGTTGAGCGTATCAACGCGTT
CGACACCTACGAGCGAGGGCTCATCGCCCACGTTCAAGGGCTGCAGGCCACTGCGGCCGCGCCGAAGCCGGTGCAACCGAAGCCCCTGCGGCTGAAGGTT
CACCCTTTCGAAGGGAAGGAAGGAGAAAACCTTCACTTCTGGGATCGAGAGGTTGAGCTCGCGATGGACGCGGCTCTCGTCTCGGACGAGCGACTCCGTG
TCGCCTTTGCGCTCTCCAACCTTAGTGGTCGCGCTAAGAGTTGGGTGTATACGCGCGAAGCGACGACGCCTGGATGCTTCGCATCATGGTCCCAGCTGTG
CGAGCAGCTGCGGGCCGCGTTTCTTCCGGCGAACTACGAGTACCGCCAGCGTTCGCGCTTTCTCGCCTGCAAACAAGGAAGGCGCGAGCTGTATGAGTAC
ATCCAGGAGATGCGAGTGCTCACTGCCTCTTTGGTGGGGAACCCCCTGCCTGAACACATCAAGGTGACCGTGTTCATGGACGGTCTGCGTGTCGGTCCTG
CCCGCACGCAACTGTTCCGTGTGCAAGCAAACACTATGGAGGAGGCGATTCAGATCGCCCTCCAGGAGGAGTACAGCCACAAGCAGGCTCGTACCCCCGC
CACGGTATGGCAGAGCAACCCTGCCTCTGGCGGTGTGCCTAATGGTAACTCCGGCAATGGAGCGATCAACGGGCCGGTTCCCATGGATCTGGGCATGGCC
GAGCAGAGCGACATTCGCTGCTACGGCTGTGGCAAGCTTGGGCACATGAAACGTGCTTGTCCCGCGGGAGGACTGAAGAAGAAGTTCTCTTCGAAGCCCT
TTGGCTCTAGGGGTCGCTGGCAGAAGCCGCGCCCCAGGGACCAGGGGAACGCCGGACACCAGTAGGGGCGGGGCGCCCTACTGGGGAAACACCAAGTCTT
CATGAGGAGCGTGCGGGT