Description :
From Genome Similarity Track
Location :
Scaffold_30:23843- 31055
Transcript NameFunction/comments
Physo_116025predicted protein
Physo_116026ATHAL3B (Arabidopsis thaliana Hal3-like protein B); electron carrier
Physo_156829lipoyltransferase
Physo_156830hypothetical protein

Sequence
7212 bases(100 bases per row)
AAATCGACACAGGATGCCGATATTGGCGACGAACATTCTTTTGAGGCTGAATCTGGTACAACACCCGAGTCGGAACAAGAGGACACTGCTGATAATAAGC
ACCAGGCATTGAACTCGTCAGTTCACACCGACTTGACTACCAAACCGAGCTGCTTAGATGGCGTCGACGGTGACGAAGAGGACACGACTAGCAATGGGAG
TGAGGCTGAAGTGACCCAAAAGCATGGCAACACTGACAACGTTCGGAAGGAGGGCAAGCTCAATATCGTGGGCGACTTTGAAGGGGTGCCAGCTGAAGAG
GACACGACTGGCAATGGGAGTGAGACTGAAGTGATCCAAAACCATGACAACTCTGACAACGTTCACAAACTCAGTATCATGGACGACTTTGAAACGGTGC
AAGCTGAAGAACCGGAGAGTCTTGGTATTATTGACGTGGAAATGGAGAACGCGAGTGTTGTCGACCTGACGGGCGAAACGCAACCGATAGATGAACCAGA
GACGGATCAAGGCCGAGAAAGTAACACCATTACGGTTGAAGGGAGTACAGTAGCTACTGATGCTCGTGACAAGCCAACAAACCCCGAAGACCAAGAAGTT
GTTTATGCTGATGTCATGGATTCATCAGACGAACCCCCCGTTCCTGGGTTTTGCGATGCGGGAATGCGACCAGAAAATGAAGTCCGTCATTTCCAAGACT
GCCTACAAAAGGCGATCCAGTTCATAGATGCAGTTCTGTGCAAGCCACCGCGCGGTAAATCGTGTGTCAGAGGTTGCAAGAACATTCGTGAGCGGCAGTG
CATAATGGGCGAACCGTGTCACGACGATCTTTGCAGTAATTGGCACAGCGCAGAAGCGCACAGGGCGCGCTGCACGAACCCGCTGTGTGAGTTTCGGGAT
CGCATCTCGCTTCGCGAAATCATGCACCAAATCGCAAACCTGGACGAATATTCTCAGGCGATGCAGGCGCAATGGCAGAAGAAAACATTGGAGCTTATCA
TGGCAACGGATGACGAGTCCACACAGCTGAACGAGGACATGAAACTGCTTCTGCGAAGCATTGACGAAGCGAAGGAGGAAATGGAGTTCCTCAAGGACAG
CAAAAGAGTACTACAGGCCAACTTGAGCGCAATTGGGATCATGCCTGGAGACGACATAGCTGACCGCTTCCCTGACGTTGAGTCACACTACATATGAGCA
AGCGTCGGGGCTCGAAAACTTGTTCGTGTTGACTCTGCATACGATGACACTTTAGCTCGGCAAAATGAGTCGGGTATCTACTCGTAGTTGGACCCCACAA
GCGTGTCATTTTTTCCCCTGAACTAAGTCCGTTGCCTACCAGAATAATAGTAGATGGTTGCCTTAACTCCCACATCCCGAAGATTGCGAGCTATCAAGCG
TTCAACAGCATACCAATTGAAGTTTGGGGTACCATATCCGATTCGGGGTAGATGAACGGTGGCGTCTAGCTCCAATGCACGATGCGCTAGCGCCTGCAGC
GCAGTCTCAAGCGCATTCAGGCGGAACGTCGAAGACTTTCCCTGACGAACGAGCTGGCCATTTCCCACGCGCTGTTTCTTCTTCGCGACGAAGCCCTGTA
CAACCAGCAGGCAGACATATCCCTCAATGGGTAGCTGATTGGTAGCTTGGGGTGGTAATCGAATCAAATGCGCACTGCCAAGCTTGAGATCTCCGTTGCG
TCCTGCCTCCTCATATTGGTTTTGTATCGAGGGTGATAGTGTTGACAGGCTGCGAAAGAACCCACGAGAGCACCACACACCACTGTTGTCCACGCAGTGA
ACAATGATGTACGGCCTCAAACGTAGAGAATTGATAGGCGGTTGGCTGGCATCCCCAGACTTGTACAGCAGTCGACCCGAACTACGCGGAGGGCTTGCGC
TGCGCGGAGATGATTGCACAGAGCTGTCTCCAGTGTTACTGACGTCAATGGCCACTGACGTGTACTTGTTGGCCTTCCATTGAGCAAGCTTTCGTTCCAA
CGCTTTTTGACGCCGCTCCTCTCGCTTTCGAGCTTGCTCCGCTTCATCCGCAGCACTTAGCTCTTCGTCCACTTCGTCTTCTTCTTCATCATCATCTTGT
TCATATCTTTTACGAGCCGTTAATGTTTTACGCTTCGTAGTATTTGCTGCCTCGGCGCATAGCTTCTGGAGCAACTCAGCATCTTTCGCCTTAGTGTTCA
TGACTTTCGTGTAGTCTTCTCCCTCGAAGTAATACATGTTTTCCTCTCGAAAATCCCCACCCGACTCCAGCAGCTTGTCACTCTTTAGCGTCGGCACCAT
TTTGTCATCGGAATCAGCGCCCGCCTCAGATACGTGATCGGTTCTTCGAGTCAAAATGTGTTGGATATATTCCTCCTCCAAAGGCTTCATCAGCGCATCT
TCGTCCTGACCAGCAGCTTCTTCCATGAGGCGATGCAAACCAAACTGAATCATATCAAGCAAGCTCTTCCCACTATCATCGTCGTTTTCATCGCCGTCAC
CATCAGTTCTTCGTGCAAGGTTGCGGATGCGGTCAGCCATGCGCATTTTCTTGAGAGAGCGTCGGTAAATGCTCTCTTCAACCGTATTCGCGCATAAGAA
CTTGATCACGTGAATAGGCTTTGTCTGTCCCAGGCGATAAGCTCGTGCTACTGCCTGAAGATCGGTCTGCGGGTTGTAATCCGAATCCGCGAAAATAACC
GTATCTGCGCTTTGCAAATTCAATCCGAGACCGCCAGCCCTTGTCGAGATAAGGAAGACGAAAGTTTCAGGATCCTTGCGAAAGCGCTCAATGCTTTGCC
AACGCTCTTTCCCACGCACAGATCCATCGATGCGCTCGTACGCAAAACTCTCGAGCGTAAGAAAGTCTTGAATGATGTCCAGAAAGGGTGGAGACTGACT
GAAAAGCAGCACCCGGTGACCTTCCTTTTTCAGACGCGGCAGGATCTGATGCAGAACAAAGAGTTTGCCACTGTTTTCATACAAGTGACTGCCTTCTTCA
AACGGTTCAGGTTCAGCGCCCGGAAACAGGTACGGGTGGTTGCACGCTTTCCGCAGTTGGGGAAGAATGTTCAGCAGCGGGACCCTACCAGACAAGCACC
AAACTACTGTTACACATATTGAATAAAAGAGATCACAGCGCGCGAAATAAATGCCGGTGTACCTGCTGCCATGAGCTTTCGCGGCACCATTCAGGACGTA
TGCATTCTTGGCGATAACCTCCTTGTAGTATGCTCGCTGCATTGACGACATCGGCGTATGAACCACCATTTCGGACAATGGTGGCAATGTAAATGCGCCC
TGCACGTCTTGAACCGTCCGCAGCAGCAACAGCGGTGCTAATAGTCTACGCATCAGCTCCTCCGCTTTGCTCAGCCGCTTGGATTTCGCGCGCTGACCCT
CATCCAAACGCTGCGCTTTCGCCGAAAAGTAGTTTCTGAACGTCGACTCGAACAGCGCTTGGTCGTTGAACACGCCCGGGTTCAGTATCGACAGCAATGC
GAAAAGCTCTTCCAGGTCATTCTGGATCGGCGTGCCCGTCAAGATCACCATGTGCTTGGACCGCAGTCTAGTCGAGACGATCCCGTGGAGTTGGCCTTTC
GGGTTCTTGAGTCTGTGGCCCTCGTCCATGATCATCACCTCCCACTCCGTCTTGCTGTAGAATTCATGGTCATGTAGCAACATCTCGTACGACGTCACAA
CCACCAGCGGTTGGTCCTGTGGACTGGCCGCGATGACCTTCTGCGTCGCCTCACGGTCCTTTGCCGGACCGATGTACATGACCGTGGAGATGCTGGGCGC
GAACTGCTCGAACTGCTCCATCCAGTTGGGCAGTACACTCAGCGGTGCGACAACCAGGTACCGACTTCCTCGAGGCTTCTTCTGGCCTCGATAAGCAGCT
TCCAGCGCTGCGATGAACGAAATAACCTGCAGCGTCTTGCCCAGTCCCATTTCGTCCCCCAGAATGGGGTTCAGCCCCTGCTCATGCTTGCGCAGCAGCC
ACCGGAGGCCTACCAACTGGTAGTCGTGCAGCGTCGCGTTCTCCAGTAAAGACGGCTGCGTCTTGACCTGGTCGGCCAGCGGCGTCGGCTGCTGCCCGCG
CAGCTCCAGCTTGTGCACCACCTCGTCCATTTTGGCAAGTGGGTGCAGAGTCGTCACTAAGGGTATCAATGACCATCACTCACTGTGTAAATCCCCATTT
TAGTGACATTTTTGACATGGATCCAGCAACGTCGCGGCTGCTGCTGTGCGCGAGCGGCAGTGTGGCGACCGTCAAGGTGCCGGAGATCGCTGTGCGTCTC
TCGCAGACAGCAGAGGTATGTTTGCTGTATAGTGGCAGCATGCGTCAGGACTAATTGCGCCACGTTGCCTTGGCAGGTGTGCGTGGTGCTGACCAAGTCG
GCGGACTTCTTCCTGCAACGCGCTAAGGACTACGACGCAAGTTCGTGGGCGGACTTCGACGCCGCAACTAAGTTGGAGGATGGCGCGCGCGGCAGAATTG
CAGTTGTGCGGGACGAAGACGAGTGGGAGGCGTGGAACGCCGTTGGGGACAGCGTGCGCCACATCGAGGTGTGCACTTGTCGTGATACAGGCGAAGAAGC
GCTGAGGGAGACGCAGGGCTGATATTTGTGTCGGATTTGAATCGCTGCAGTTGAAGGACTGGGCGGATGTGATGCTGCTGGCGCCCATGTCTGCGAACAC
ACTGGGCAAACTTGCAAACGGATTGGCCGACAACCTCCTCGTGCGTTGCTGCTTGTACTCATCATTTAAGTGAAAGAAATTGGTTATTCACGTTTTTGGA
TGAGATGCTGAGCAGACCTGCGTTGCACGAGCGTGGATCATGAGCAAGCCTTTCATCTACGCGCCGGCGATGAACACGGACATGTGGAACCACCCCATCA
CTGCAAAGCAGCTTCGAGTGCTGGACGAGTTCGGCTACAAGATGGTGCCCCCTGTCGAAAAGAAGCTGGCTTGCGGAGTGGTCGGTAAGTAGTGCTGCTG
TTTGTTTGGATACTGTGCACGTGCTCTATTCACAGTTACCGAAAATCTAATCTATGCTGATCAATGTGTCAGGCAACGGAGGTCTAGCAACAGTCGATAG
CATCGTCGCCTTCACGCTTCACGAGTTGAGTCATCGATCGCTCATCGACTAGATCAAATCAGCAGTGAATCATCAAATACAGCGGTACAATGCGCTCTAC
AGCGGCGTCGTGGCCTCGACGTCTTCCATGTCGAGGTGGAAGACCTCGCTGATGGCTTCGATAGCAGCGTCCTGCACATCCTTGACCGTTGCATCCGGAC
GAATGCGCTCGATACTTGTAACCGCGCGATCGTCGATTCCGCACGGAATGATGCGATCAAAGCCGCGCAAGTCCGTCTTGACGTTGAGAGCGAAGCCGTG
CATGGTGACCCAGCGACTCGCGTGCGTTCCGACCGCGCAGATCTTGCGCATATCGCGCTCGTAGTTGCCCTTGTGGTGCTCTCCATCTTCCGACATAGGC
TGCTCCTCCACCCAGACGCCCGTCAGTCCGTCCACGCGCTCGCCCTGGATGCCGAACTTGGCCAGTGTCCGGATCACCACCTCCTCCACCTGCCGGAGGT
ACCAGTGTAGGTCCTTCTTGTGCTGTGTCAGGTCCAGAATCGGGTACACCACGACCTGTCCGGGGCCGTGGTACGTGACTTCGCCGCCGCGATCGACGCG
CACCAGCTTGACGTGCTCCGTCTCCGGGTCGAACTTGACGTTCTCCATGGTGCCGCCTCTGCCGAGCGTGTACACGCTCGGGTGCTCCAGGATAAGCACC
ACGTCCTTCTCCACCGACTGGCCGGCACGCATGGCCACCACGCGCTGCTGGATGAGCTGCTTCTGCCAGTCCCACGCGGTCTCGTACTCGACGCGGCCCA
GGCGGTACGCGACGCACTTGCGCGGCGTCTGCGGCGTCTCCACGGCGGCCGATTGCGTGGACAGGAATCGAGGCGACATGGCTCCAATCTGAAGGCAACG
CTGGTGTCTAGAGGCCATGGAAGAGGCCGCTGCCAAGGCGCCGCGCCGCCCACTGCGGACGCTCATGTTGCTCTGCTCGTGTCAATGCTGCTTGGGTTGG
GTGCGAACTTACCGAAGGCTTGATTGATAAGTTCGCTGGCGGGAAGTGGCGCTGCCACTTTACTTAGGCACCTAAATGTGGCAGCGGAGCGGGTGGAGTG
GGTCGGAGTGCCAAGTTTCTCCCAAACTTTTTCCCGAGCCATTTAAACAGGAAAACGCTTGTTTATGGCGGGTTTGTGGCACCAAACGGGTCAAGTTTCG
ACCGAACCCGCGAAACTTTTGTCGCCACAAATAGTGGCGGAGACCCCCCACATTCTGCCACATTCTGCCACGAACAGAGAGGGCATATGCGCGAAAATGG
CGCCAACGCCTGGCGCGCCCAGCTCCTGGCGCTGCTCCAGCGGCGTAGGCAAGCGCAGAAGGCGATCGCGCTGTTCATCCCTGAAGCATCAGCTGCTGCA
CGCGACGCTGGAGCATTACCGGCGTCGTCGCTCGCCTTGAAGCTGCTGCGCGCCGCGGTCGAGAGTCGCCGCCCCGAGTGGACCCAGGCGCTGGCAGTCG
AACGCGATCCCAAGCGCCAGCGACTGAGCGATGGCGGCAAGAATGACGTCGTGTTCGCCGCCAAACTGGCGCAGAGTATTGTGAAGACCTACGCGCCCAC
TAGCGCTGCTGCCGTAAAGGAAACAGGTCGACAATTGAGCATCTCCTCTCTTGAGTGCCTTTGAAGTACTGATCATTGGTGTTATGTATTGCAGAGCTGG
AGGATTTCGTGGCAGCGCTGGATCTGGCGTGTGTGGCGCTTTACGTGGTTTGTGCGTTGGAGAATGCGGCTCGACTCGGGGACCTCGTCGTGGACAATTT
GCTGTATCAAGTAGCCAAGAAGCTCGCCGAGATTCCTAGTGTACGTTGCGGCGCAGTGCCATTGATAGTGTAATGCGGCTTTATTTCTAAATGGGTGTTT
GGATGTACAGATGCGCGTAGCTGCGAGTTGTGTGGCTGCTTGTGTCCACGTTCGCCTGTGGAATGTGCATGCTAAAGTATGTAAAGCCTCTGATGGCGAC
ATTGCGGAGTCGTCGCAGTTGGTCATGTTGCTTGAGCAAGAAGATGATTGCTCGAGCAGAGTGACGCAGCAGTTGGAGCTGGCGGTGGAGTTCCCAGAAC
CAAGGAGTTGCC