Description :
From Genome Similarity Track
Location :
contig_162:23841- 25456
Transcript NameFunction/comments
g11835.t1hypothetical protein

Sequence
1615 bases(100 bases per row)
GGGGGGCTCCAAACGAGCGGCCACGGAACGGCACTTTTCTATAGCGCAGACACTGTGGACCACACTGAAACCGGTGATACAGAATGAAAGACCTGCCGTA
TGGCATATCTCGTTTTTTATGCAGCAAGCTATTTTTTATTGGTGGAAAAGGCAACTTCAAGTTGCCTTTTTAGAATTTGTGTGCCTTGCCTTGTCCGCCA
AGGCTGTTCTGGTTCTGAGGTGCAGCAGCTACAGCCCCATTCTCCTCAGGGACGGACGCCGCTGGTTCGAGTCAGAGTCGGCTGGCATGTCACCGAGCGG
ATCGATGGGGCCCGTGAGGATACGACCATCGCGTGACTGCCATTCGACATGAAAGCAAAGATGTTAGCTAACTGCAGTCGCAAAAGAAAAACTACAACAG
AAGGGGCCCACCTTGACTGCAGGGCTCTGTCGGCGAGCCAGCGGCGGGTACATTTGTGCTCGGGTGTAAGCGGATCCAGGGCGTGAGAATGACGAGATCT
GCCAGAAGCGAAGAGAAAGCAGGTGGGAACAGATTTTTGCCGTGCGCGAGGCATTTACAGACGTACCGTGTCGGCTTTTATGTCGTTTTGCTGAGTCTGC
TCAGGCTGGTCCGGGAGTTTGCGGATGATTCCTTTTGCGATCAACTCCGACTTGAGGCTCTTGTTGCAACCTTTAGCTATACAAGTTGAGCAATAGTCAG
GAGTGTGACGAGGTCTGGAGCATATTGTGACCAGTCCTACCTGAGAAGAAGGGCCAAATCGCCTCGGAGATGCTGGCGTAGTCCACCGGCCTCCGCCCCT
CCGCGTCGACCATTTTAGGATCGGCCTGGTTGTCCAGCAAGATGCGCACGACTTTCCCATGCTCTTGGAATGAGGCTGCATGCAGAGCTGTCCACCCCGT
GCCTGTCGAGGTGTTGGTGTGTTAGCCTTCTCTCGAGAATCACGTTGTTCTGTAACAAGAAGTCTGGCTTACCTTCGTTCCTGGCCGACACGTCGGCTCC
TTTGTCAAGCAAACATGTGACCATCATGTCGTTCCCCCACAGAGCTGCAGCACATAGTGGTGTCGTTCCATCTGGTGAAAAGGTTGTCAATTCCATATAC
CATGTACAACGAAACATCTCCATGCAAGTGTGGAACAAATTTGTATCAATGTGCACTCCATTGTCCAGTAGGAATTCCACCTGCGGTGAAGCAAAATCAT
GTTAGAAGATTGCGCCGATGTCGAAAGCTGCAGATTCTGCCGCACACATACCATGGCACGAGAGCCGTTCGCTGCCGCCTCCGCAAGATCCACGTGCGAG
CGGATCACTCCTTCTTGGGCCTGTTGGTCGTCTCCATCCATGGTGGCGCACTAGCTGCTTGTCTTCTAGGAAGAAGCAAACTCTTCCAAAATGTTGAAAC
GGATTGCGACGCTTCGAGCAAAGAGGACACCATCACAGTCAGCTCGAGGTGTATCGAATAGAGTGGCGTCAATAGATATTCAATAGGGGTCTGTGAGCCT
TTTACGACGTAGTTAGATTTTCGAGACATTTGGCAATTGACACGCGATAGACGTTTGTGCCGTGCATTGTCGTTTTGCGCCGAGATGAGTGATGAAGGTG
GCGCTCCACGAAACT