Description :
From Genome Similarity Track
Location :
Scaffold_2038:2384- 5473
Transcript NameFunction/comments
Phyta_totarag14033hypothetical protein

Sequence
3089 bases(100 bases per row)
CAAGCCAAGATCACTGGCAAGATCAACAGTGTGAAGGCTGTCTTACTCTTAGATACTGGTGCCGAAGTGTCCATCGTGGACACTGCCTTTGCTCGTAAGG
TTGGGTGCTATATCGACACAAGTCAGAACCAAGAGTGTGTTGGAATTGGTGAGAACGTGTATACGACGGAAGGAAGAACTCGGATCAAGGTCACCCTAGC
GGGATCGCTAGTGTATTTCATCGATATCTGGGTGGGCGATCTatctggccaagaagctaTCCTAggcatggacttcatggttCCTGCGGGGATCAGACTG
GATCTGGCTGATGGGTCTATCCGCCTGCCCGACGAAGTAGAGATCAGGCTCAGCGGACGTCGACAGCTCTATAATGACAAAGCGAGGATCTTGAGACTGG
ATCAGTATATGAAGATCGAGATCGGAGAGTCGGTGGAGCTTCCGAAGCGCCTGCGAACGTCGGAGCATGAGAAGTTATGGGTCACCCGTGGTGAACGTTG
GGTACCGGCGGTTACTAAAGGACCTGGACGAATACGACACCTGCAGATCGCCAACGTGTGCGAGAAGAAATTGATTTTGCAGGGCGATGAGAGGATCGGG
ATCTGGCTCGCCAGCGACCgtgttcctcgtcttccaggATTCGTGTCGATCGGATCTCGTCGTTACATGGAGTGGCAGAATTTTGCTTTCCAGGCTACCG
CCGACgggcagtctgcagcgcaagagGCTCCGGAACCAATACCAGAGCCCGCCGTCGATCGTCCGACCTACCCTACGCCACGCGCCATACTTCAGAGGGG
CAAGATTACCCAGATCACGCGTGGATCCGCTAGTTCACCTGTCTTGAAGTGCAGATCGGAGGCCCCGTCGTCCGATCAGGTTATCACTGGTGGTGAAGGG
CCGAGATCGATGGAGGTAGAGAGGGTCGAAGCAGATCTAGCGAGTCTGGAACCCGAGGACTTCCTCCAAGTCAGATCAAGCGTGGTCTAAACTGCCAAGA
AAGCTCACGATGTAGATCGAGGTGAAACTCGGCCCAGGGATGATGTGTCGGAGATGGATCGAGCCGGAATGCAAGATGGAGGGGCGATAGTCGAGGCGAT
CGGTGATCACCCTCTGCCAGACGATCAGACTGTCGGAAGTTCGATCAGCTCAACTACTGGAGACCGACTGTCTAGTTTGGGACCTGTACAAGATGCTCCG
CAACGGGATCTACCCACGGACGCCGAGGACGGACCAAGATCAGCCAGAATTGCGATAGTTGAGGCAGACCCGGTGTTGGATCCAGCGTCGAGCGCGTCGA
CGCAGGAGGTTACCTGTACGAATAGCGAAGTCCGGGCAGAGCTCGACCTCGCGGGACCACGGGCCACGCTGGATCCAAAAAACCGAAGCAGATCCGAGGC
GGAAGGCGAGAAGTCCGATCTACCGTCGACGGTGATCCGAGGCGCTGGATCGTCGAGGGATACGGACCGCAAAAAGAACTTGGAGTCTATCGACGAGGAC
CGGATCCACTACCATGAGGGTGGTGAGCTGATGGCAGAAGACATCGAAGGCGAGTTGGCAGTGCTTCCGGAGGTTCTCATTTTCACGACAGACGAGGTGA
CGATCGAAGATATCAAGGTAGGCGATCTGGAGTTCAATACCCCGGAGGAGATCGATCGACTACGAAAGAGGATCTGGCGGAGAAGACACCTCTTGATCGG
CAAGGGCAATGCACTGCCGCCGGCAGCCCGAGGTGTTATGTGCGACATCAATGTAGGCGATGCAAGGCCGATCGCATAGCGAGTGCGGAAAGTGGCACCG
CGATTCTGAGAGAAGGTGTCAGATCTGATCAAGGGTTTATTATCGGCCAAGATCATCAACCACTCGACGTCCCCATGGGCGTCACCGATCGTGgtgatca
tcaagaagaacggtgTGGATATACGATTATGTATTGACTATCGATTGGTCAACGGTCTAACTCGGCTGATGGTCTACCCGATGCCACTGATCAACGATCT
ACTCGAGGATCTGGACAAGGTATTGTGATACTGCTCTCTGGATATGGCGAGCGGGTTTTGAGTGGTGCCGATGACCGATCGAGCTCGTGTGATCTCGGCG
GTCATTACTCCGTTCGGCCTGTTCGAGTTGAATCGAATGCCATTCGGCCTCAAGAACGCACCCCAGATCTACCAACGGCTCCTGGATAACGCACTGTATG
GATTTATGCGGATCCCGCGATCAGAGAATTCTAAAGGTATCGTGGATCTGTTTGAGGATGGAAAACCGGAGGATCCAGGATGCTCATCGGTGTTAGGACG
CAGATCctacatcgacgacatcttAGTGACAGCCGGATCCTGGGATCAGCTATGCAATCGGGTGGAAGATCTACTGGAAGCGTGCGATAAGTGGAATCTG
TCGATCAGCGTGGCAAAGAGCTTCTGGGGGTTACGCAAGGTGGACTATCTAGGACATCGGGTGTCGAGGGAAGGTCTAGAGGCCAACCCCAAGGATCTGT
CGGTATTAACGGATCTGCCTTTCCCTGGATCACTCAGATCGATGCAGTCTTTTCTGGGCAGCTTAAATTATTACGGCCGCTTCATAGAAGACTACGCGAT
CTACGCGGCGATCCGATATGAGTTGCGGGAGGTGGACTTCGCCGAGATGAGAACACGTCCGGGTCTGCGTCAGATTTTGGGGAAGCTAGATCAGGAGCCA
CCCGATCCAGCATCGTCAGAACTGGGGGCGCTGGATCCAGACCAACCAGACCTCGACGTCGCGGACGGGCGATGATTCCGAGCTCACAAGGCTTTCACaa
tgttgaagaagaaggttgcGACGACACCGACTCTGCGTCACTTCGATCCAGATCGACTACCAGGGGTGATCGTGTATGCCAGTGACTGGGCGATCTCGGC
TGCTCTGGTGCAAGAACACGATCGGATCTACTGTCCTGTCACCTTCGCCAGTCGGACGCTCAAATCGAACGAGTTGAACTACaatgtggtggagaaggaa
gtgctAGCGTTGCTGCGGATCCTAGATCTCAACTACAATATGTTAGTGGGGCGCCAGATCCGGATCCTTACTCGGCACTCAACTCTGTC