Description :
From Genome Similarity Track
Location :
Scaffold_3:2383406- 2386317
Transcript NameFunction/comments
Phyin_T30-4PITG_02516Putative uncharacterized protein

Sequence
2911 bases(100 bases per row)
CTTGCAGCGTATTGGTTTTTGAGGAATTATGTGGCTGGTGGCTAATATGTTTTTTTATATCTGTTATAGGACCCGATAGCATTAGTTCCCGAGCTAGCTA
AAATGGGTATTCAGGTACGCTATCGCTGCAACTTTATCCTCATCAAATCGTGCCACTTTTTTTTTAATTAATGGCTACATCTATGCGTATAGGGCATCGA
AGTTTATCATGACACGAATAAAATCGACATGTATGGCGCCTTGGCAAAGGAATCCGGCTTATTAAGGGTATGTTTACGCGCATAAAGCATTAGTACTTAT
AACTAACCTTTCTATGTTTTTACGGTAGATGGGTGGATCGGATTTCCATGGTATTGACCCTACGACAGAGCGAGCCCCGGGCGCTATTCCTTTCCCCCGT
CTTCACGTTGACCGCTTTCTGGCCCACGCGCTAGATGTGTGGGAGCGACCACTCGTTGAGCGACTACAAGCCATGGCTAAGGCAATCAAGCTGGCAGGCT
CGGATTGCGAGGTATCAGAGGAGTTGTTGATTTGGAAAGAGCAGGAACCACTAGCTCGCCGAACGTTGGCAGAGCTTGACATGGGTGTTGAGATAGTAAA
CAAGCAAGAAACGCATCCCGACGGTGGCCCCGGTGGCGACAACGTCAGTGTTGCTGAGAGCCACTACCGTACTATCCGCGTTACCACTCTCCATCGGTGA
GGATGGCATGACAGAGTAAGAAAAGCGGGGTTTCCAACAAATACTTGGGTGTAACGTCTTGCAGAAACTCTAAGTGAAGCAGTAACAATGAAAGACAGCC
ATTCCTAGATGATCTTATAGCTCGCGCAGAATCCCAGTCCAGGTGCTCTACTCGCTGGCCTGAAAATACGCAAAAAAACTCATATAATTACTTTTTATTC
TGAACTCCAGACATTTTGTCCTTTCAGATTTACTGTCCTTACCAAATGGCGGTCGATTTATATTTAAAATCCTCATCAAATTTCAACAGCAACTCATACT
TTAATGAGTCGATTTAGCTAAGTCCACAACAGCTAAAACTGAAAAGATGATACAGAAATTGAGCCCTAACCATTACTTAGTACTGTAAACGCAACTCTGA
GTCACAAAGTTATGATAGAATAAAGTTGCGAGAATCGTGTTGAATGCCTCAGTCTAAGTAGTCATGACAGAGAAGACCTCTTTGAGGTGACGGCGATAGA
TCCGAAGCGTTGTGCTCTCTCTTCAGCGTGTTGCCGCTCTCTCACTTTTCATTTCGTCTTCTTCTTTGCACTCTTGACCAACCGCCCTACCAGCACCACC
GTCAAACAACCAAGAAACATCGCGTTCAAGATGCATTCCAAGATCATCCTGTTGCTCGGTGTTTGCGTCGCTGCCTCCATACTGCAGACGGCTGACGCAC
GCACTACCGGGCGCAACCCTCGTAAGCACGATCATGGGCATAGGCAGCATCACGGCCACGACCACCACAAAGACCATTCGCACTATAGTCGCCGCTTAGA
AGACAAGGACAGCAAGGACGACAAGGACGACAAGGTCACGGAGGTCATCATGAGTGCACCAGGAGCTTCGGCAAATAGGATTATGTGCCGAAGGACAATA
AGTAAAGCCAATGTGAGTTTTAAGTAACTCTTACGTAAATTTACGTAGAAAGTCCGGAAAAAGTTATTATTTGAGGTTTAGGACAATCTGGAGGACACAA
ATTATAATATTCTGTAACGAAGGATTAGTCGCTTTTTAGGACACATCTCCAAAATCTCCCTGTAAAATTTAGGACAAATAGGACAGTTTAGGACGTGTCT
TAGGACGCATTATCCTACACCAGCACCACGGCCACGGCCACCACAAAGACCATTCGCACTATAGTCGCCGCTTAGAAGACAAGGACAACAAGGACGACAA
GGTCACGGAGCATCCGAGTACACCAGTAGCTACGGCAAATACGATTATGGCCGCGACGACTATGGCCACGACGACTATGGCCACGACGATTATGGTCACG
ATGACTATGGTCACGACGACTACAAACGGAAGGGCCACGGCTACGACGACCATGACTACAAGGGCTATGGCGTTGGCTACAGCTAGGGCTACTAGAGCTA
TGGCAAGGACTACGATGACTACAACGACGACTACTACGGCCATGGCAAAAACTACTACAGCTATGACAAGGGATACGGCAAGAAGGACTACGACTACTAC
CCTGACTACTACTCGTCGTACAGCGGTGGCTATGGTTATGATGGCTACTATAACAACGGATACTATCCCGATTCCTACTCGTCCTATGGCTACGGTGACA
AAAATGGCTATGGATACTACCCAGATTACTACTCGGCCTATGGCTACCCTAGCTACGGTTACGGCTACAGCCACGGCAACAGCTACGGCTATGGCAACCC
CTCCTACGGTTTCGGATCCCCGGGATTCTTCGACTACGAGTCTGCTGCATCGGACGCTGGCACGGACAGCACTCCGAAGGAGCAGGGTTCGGACGCGGCC
AAGAGTAAGTCGGAGAAGAAGGAAGACAAGCCCAACGTTGAGAAGAAGGAAAACAAGTCGAATGCCGTGAACAAGTCGAAGGGCAAATGAAGACGTGATC
AGAGAAACATGAAGCGTGTGCAATACGTAGCGTTGGAAAGCAGAGGTAACAGTAGAAAATACAATGCCAATTAATGTGACGTGGTAAATAGTTAGAGCTT
AGTTCGGACTCGTCCCTGGAACACCAAACTCGTCCCTGGAACACCGAAACCAGTCCGTAAGAAAAGAGCTATAGTAATAAGCGCCGTTGCAAGGACCATT
TTATGGACCGGGATGCCCCTCTAGTTGATATGGTTAGTACTTGATATGTTCTACGTCGAAGGCTTGATCTGTGTGCATTTCTATTATTTCATGGTGCGTA
CAAATGGATTA