Description :
From Genome Similarity Track
Location :
Scaffold_274:23833- 25226
Transcript NameFunction/comments
g11110.t1hypothetical protein

Sequence
1393 bases(100 bases per row)
TGAAGAACACAGAAGAACACAGAAGAACACAGAAGAACGAAGACAGACAGATACCCTTTACGAAGAAGCTAGCGATCGGCTAGCAAAGATAACAATCAGA
GTTCGTTTAACCCCCTACTACGCAAGTCGCTCAAAGTAAGTGAGCTTCCGACAAGCAGGACACGGGTCCGCCGTTCAGTTAAGGGCAGTTCGGTGCGGGG
CTCTCTACAAAATTCAAGCCCAGTTGCGAGGGGATCATTCACGTAAGTATTTGACGTGATCCTTGCATTCCCTTTATTAGTTGGACCCGCTGCGCGTACG
GTAAGGGCGGGGTTTTCATTTCATATTAACAAGGCCTTCTTGGGTGATAGTAGCAGTCATCCCCAGGAATATTTGATAGACTGCGTTTGAGATAGGATTG
TATTGGTGTGTATTATTTCCCTCATCTGAGGGTGGTGCGCGTGTGAAGAAAAGGCTTCAGGATTGACCAGTATCCTGGGTTCAGCCTTAGTTGACTGGTG
TTCAGACCCACCGTTCAAGGGTCTATAAGAATAAGTAACGGCTGTGTGTTGTATATAACTCTGTATTTGTATTGGGTATCTGAAAGTGGTGTTGTTCCGA
GTTCTCAATACCGGTTCCAGACATTGGAGAAGTACATTCAGGAAGTGGACGTTACGCTCAGCATCTTCAAGGCCTATTTGTATTTGACAACTCATTGTGG
TGATATATCCGAGCTTCCCCCGAAGCAATCGACGCCGATAGGGATTACACAAGGTGCCACGCCACTCTGAATCACGGTTTCAAGGAACCGCGTTCAGGGT
TTACACCCCCCAGGCTTAAGTTTCAGGACTAAGTCTAGGCTACCGCTATACACTTGGGCGAGAAAGTTTCATCGACTTCGTCACAACTGGTGCGCGATCC
CGGATTTGGGGTCTTAGGATTTCACCGGAGTTGTTTATATTAGTAGGAATTGATTAGTTGGGTCTCGTTAACTTCTAACTACTCTCTAATGGCGGGAGGA
CGAGGCAAACTGAAAGGAGGACGTGGAGACGGCGGACAAGCAACACGTGTGTCGCGCCGAGCGCAAGGACTGCCTGCAGAAGAGCATAAGGACTTGGACA
CAATCGCCCGAGAACGACGTGCACGATTGAAGGCAGAACGAGAGGCGAAGAAGGCTGAAACTGAAGACCAAGCAGTCATCGAACTGGAAGCTGCGGGAGA
CGTAATGTCGACTGCGGAAGCTGGTACTGGTAACCAGCGGTCAGAGGTGAAGCCTCAACACATCTCGGAGGAGCAGTCTCAGTCAATGGAGACTGCGCAG
GCGTCTGTGGGATGCGCCAACGAGGTTGAGACCCCAGCAGTGGATTGAGTTTCGGACACTCTGCTGCCGGTTGAAGAAGAAGAAGAGCTTGCT