Description :
From Genome Similarity Track
Location :
Scaffold_82:238322- 242532
Transcript NameFunction/comments
Physo_140160reverse transcriptase
Physo_140161reverse transcriptase

Sequence
4210 bases(100 bases per row)
GTAATCGTACAGGTGGCCACCGCACGAGAGATTGGACGCTGGTTCCCATGTCGGCTCGTCATAGCCGACCCACTTCACCTTGAACTCTCGGACGGCCCGG
TGAGTGCTCGTTGACAACGGTGTCCGGTCATCGAGGATAGCCTCGACTTCATACTCACCGTCCAGGCGATCCGGCTCAAAACTGTCTTCAGGCAGTAATT
CCTCGTCGAAGTCAAGACGAGTGTCTTCGGTGACCTCACGAGCCAAACGAACCCTCGGTCGGCCTTCGAACTCGTCCACTGACTTGAGTCGTGAAACATG
CACCACCGGGTAGAACCGGTATCCACTTCGGTCGGGTAATTCCAACTCATACGCAAATTCGTCGACCTTCTTCTTCACGCGGAACGGTCCGTGCCACCGA
TGGGCTAGTTGCTTGGTCAGTCCTGGTCGAACCCGCTCCATGTACAGCCACACTCTGCTCCCGGGCTGCAAAGAAAACCTCGTTCTCGTCACTGCAGCTC
TACTATGGTCAGGGGAACTCGGTGCCCGGTCGACCGAGGTTCTATTCTCGTTGACGCCTGCCATGGCTTCCTTCTCCTTCCTGCCAAGCGACGCATTGTG
CTCTTCAGCTCTCCGAGCCTTTTGCGCGGCTTGGTACTCCTTGACCATCCTCAGGGCGATTTCCTGCTGTCGGTTGACCTCTCGGCGCCATGCTAGCGCG
TCAGTTTGGCTACCGAAGCCTCGTTTGAGTGACAAGGACATTGCCTTGAGCGTCGACTGTGCATCCCACCCATGAACGAGATAAAACGGAGTTTCCTTCC
TCGTCGTATCACGGGAGCTATTGATGGCGAAGATCAGTCTTTCGGCGATCTCGTCCCGATCCTGCTGTAGTGGGTCTTTAGCGTATACGCGGACTGACTG
CATGATCGTCTTCACCGATCTCTCCTGCTGGCCGTTGGCCTGCGGGCGGTAGCTCAGGGTCGCTCTCGACCGAGACTGCATCATTTCCGCGAAGGCTTGG
AAGACCTCGCTCATAAATCGAGGATCTTGGTCATGACGGATCAAGGACGGTACTCCAAAACGTCGGTAGACACACTCTTCGAAAGCTTGCGCAACGAGTA
AGGCGGTAGTATCAGACATGGCTTTGCCCATCACGAATCCCGTGAACGAGCATTTGAAGAGCAGGATAGCCGTGTTGCCACGGCGACTCTTCGGTAGCGG
TATCACGAAGTCCATAGAGACTAGTTGGAAGGGTCTCTCGGCTAGGATGTTCCCTGGCGAGTACCCGCGGAACTGAGGTCGGCTCTTACTTGAACTCCAG
TCAGGGCACGACTTAACGTGTTTCTCCACATCGGCATACTGGCCGATCCAGTAATAGTCTCTTGCCGCTCGATGTAGCCTACGGGTAATACCTTGATGAC
CGCCTTCAAGTGAGTCATGACAGCTTTGCAGGACCTCTTGGATCATCGTTGTGGGCACCACGAGTCTCGTCTTCAACTCGGCTTGCTCGCCGTCACTTGA
ACGACGGCTCGTTCATGTGTAATATAGCACATCGTCCTCACTCAACACAAATTGGTCCGCCATTTTCCATGCATCTCGTGCTGCTCTGTATCCAATCTTC
GCATCATCTCCCCGGAGCACTACCTTCAGATTCGACCACCGTAACTCTTCATCTTGAGCGGAGGCGATTCTCCTTCGGCGTTCTTCCTGTACTACCAGCG
GGTCAATGTCTTCTGCGTTCGGTGGGACTGGTGACGTCTCGGCACGCAGCGGTGAAGCTTCTGCTTCATTCTGAGACTCGTTCGGTACACTATTGGCTTC
TACTCGGTGAGATGCGTCTCCCTGATCGGTGATCGAGACTTCATCTGCAAACCGGACGTGTTTCTCCTTTGCTCTCGTTTGACGTCTGGTCATCACAGCT
ACGTGTCCGGGTTCAGTCTCGTTCTGCCGTCTGCGGTCGGTTTCTCTTCGCACAAAATCGAAAAAATTCTTGCTACGAGGTTTGGCAGAAGCTATCACGG
CCCATACTGTGTTGGCCGAGGGTATGTCCTCGACGACGCAACCGTCAGCAGCCTCGTAGATGACTTCAGCGATACGGTTCAGCTTAATCAGCTCTAATAC
TCGGTCGTCCGACGATACCACCGTAGACTCCTTGCACTCGAGAGTCTCGCTTGCCCGAGAGTCGGCCGCAGCGTTAAACTCTCTCACCACATGCAGGTAC
TTCACCGGCCGAAGCTTGGCCGTGAGTTCTTGGTGGTGGCTGAGTTGTTGCAGCAATGACTCCTTCCGACAGGCTATCACCCCTAGGGCTTGCTGGATCG
CGAGCCTCGAGTCGCCAACGACAACTAGATCGTCGGCTTCGTGCTGTAATGCAGCAGAGACGCCGTTGTTCATCGCGGTGTACTCAGTGAGGTTGACCGT
GGTGTTCTCGAGGTAAGCGCTCGCAACAAGCACTACTGTCCACACTGGTAGCTTCCATAGTATCCACGAGCAACTGCCGTATCCACCGTTCTTCTCGGTC
TTCGCAGACCCGTCAAACGACATAACGAATCCTCGGTAGGACCGCGGTAGGCGTGCGTAGAGCAGATGCGGGTAGTTGGTGACCCTCGTGTCCGGGGTGT
GACCAACGCCAGTGACTTATCCAAGTCAACGAAGTTCGTCAAGCCGGCTTGAAGTAGCCGAGCAAACGAACAGTCGGTTTCTTCGACTCGTTCGACCAAC
AGGTGCAACGGCGACAGCAAGACGGCGAACTGGGTAGCCCGACCGAACAATGTCTTGGACTTGTGGACCCAGTCGAGTGTCGAAAACCGAGTGTATACCC
GGATTCGCTGTCCAACGAGTTGAGTATAACACACCTTCAGTATCAGCAGAAGCGCGAGGACCTCTTTCTCGGCCGGGTGATAATTCATCTCAGCATCCTT
CAAAACACGTCCGCAGAAGCGAACGTGGTGTAGTTTGCCCTCGTGCTCTTGCATCAACGTGGAACTTAGAGCCCACTCGTTGGCGAACAACATGGCATGC
ACCTCCTTCTTCCGGTCGAAGTGTCGTAGTATCGGTGCTGCTGAAACCTTCTGTTGGAGCATCGCGAAGCTGTGCTTGGCCGCGGTGAGGTCAGCCCCGA
GCTGGAAGTCCTCGTCCTTAAGCTGGTACAGCGCTGCTCCATAGACCGCGAAGTCTTGGATGAAGCGACTGTAATAGTTGAGTGCCCCAAGGAAGGACTG
CATTCCTTTCCTCGTTGACGGGAACGGAAGCTCGGCCACCCCCAGCCAGCTTCTTAGCGTCCGGTCGGATACCTTCTGCCGAGACTTCGTGGGACAGGAA
GTCTACCTTGGACTGCACAAAGATGCTCTTCGTGAAGTTGATACTAATACGGCACTCTTCAAACCGTGCCAGCAATCGGCCTAGCCTCGCCAAGCACGAC
TCGAAAGTCTCGGCACCGAAACAGATATCATCCACGAATGACCGGCGACTGAATACTGGTAGTCATCGGGCTCCCCGTTGGCGAACATGTCGGTGATAGG
GCTGTTGACCACTTCGGCTACAGCTCCCTTACCAAGCGAGTTGTCTCGGTCGGCCTCGAACTTGGTCCGGAATGGCTTTGCCGTGCCAGTCGAAGCCTCG
TTCACCCCAGCATGAGCTTCCTTGTCATGTTCTTCAGCTAGATGCATGCGCTCCGAGAATTTAAACCATCCCCCCGTCGGTTGGACGAAGCCCCAAAGCG
CGTTGTCAATCATGCGTTGATAGATCATCGGTGCGTTCTTCAGGCCGAAAGGTATACGCAACCATACGAAGTGCCCCAGTGCGCAGACGAAAGCAGAGAT
CATCCGAGCTCGTTCGGTCATCATAATGGCTCAGAAGCCGCTAGCGGCGTCAAGCGAGCAAAACCACAAGTACGCCTCCATGTCCGTCAGCAAGTCATCC
ACCAGGGGCATGGCGTACTCCATAATCTCGGTGATCGCATTAACGAGTTTGTAGTCGATACACAGGCGGATTTCCACCCCATTCTTCTTCAGGACGATGG
CGATTGGCGACGCCCATGGGCTGTCCGAGAAGGAGATAAGCCCGGCCTTCAACAGACCCTTCAGCAATTCGTACAGCTTACCGAGGAAGCGAAGCGGGGT
CCGCCGAGCCTTCTGCTTGATTGGCGCGTGCCCCTGTACATTGATGTCACACACGACCCCGTAGGCTGGAGGCGGCAGGGCGTTACCGCTCGCAATCATG
ATATTCTCGT