Description :
From Genome Similarity Track
Location :
contig_48:238236- 239410
Transcript NameFunction/comments
g8381.t1hypothetical protein PHYSODRAFT_555724

Sequence
1174 bases(100 bases per row)
CGCGAGGTGCTCCTTTGAGAACTCCACAAGCGGTGGAGTAAAAGTCTCCGGACCTACTTTGCTTCCCGTCACATCCGAACGAATGACGGCTGCCACAATC
TGTCCCCAGGTTTCGTCAGGAAGTCCAAAGACTGCACACTCGAGCACCTGCGGGTGGTCAACAGCACCCGCTCGACGTCCAGAGCCGACACCTTGTAGCC
TGCAGTCTTGAGAATGTCAGCACTCGCTCGTCCACGGATGCGGAAGCTCTGAAGTTCGTTGCTGTACTGCACAATGTCGCCGGTCTTGAACCACCCGTCC
GCGTCGAACTCCTTGGCCGTAACCTCGGGCTTGTTCCAGTACTCGCGGAAGACGGACGGCCCCTTGACGCGCAGCTCGCCTTCCTTCTCTTCATGGAGCG
GCAGCTCAGTCTCCGTGTCGGGGTCCACTACGCGTACCGACACACTCGGGAAGGTGTTGCCCACGTATCCAAGATGACGGTCCCCATGCAGCGGGTTCGT
GAGCACCATGCCAAGCTCCGTCATACCGTAGCGCTCAAGCAGACGCAGTCCAGTCAAGCTCTCCCAGCGGCTCAAGATGGACACGGGGCATGCCATCGAT
CCACTGATGGCCACGCGCAGTCCTCGAGCACCTTCGAACACCTTGGGATCTTGTTGCGGCTGCTTCTCCATGACTTCCAGCAGCTTCATGTACACGGTTG
GCACCGCCATGAGCATGGACACTGGGCGCTTTGTGCCTGCAGCTTCGCCCAGCTTGGACCAAATAACGGGTGGCTTGGCAGATGGCAGGAACTCCACAGA
CCCACCCACGTACATGACACAGAGCAAGTTGTTCAGAATGCCGTGCACATGGTGCAACGGCAAGAAGTGCAGCAAATGGTCATGGCTGGACATCTCCCAC
GCCGTCACTAGATCACTGATTGCGCCGTGAGGGCAGCGTGCGTGGTCACTACGCCCTTAGGACGCCCCGTAGTGCCACTGGTGTAGATCATGTAGGCTCC
AGCCTTGCTGTAGTCTCTGGTCTCCAGCCACTGCTTCACCTCCTTCTGCTGCTCAGCCAGCTCCGTATCATTACCACCCTCGACATCATCTGGACGCACG
ATCACCTGCACGTTCAGCCTCGTCGGGAGGCCAGCAATGTACTCCTCGAGCGTGGAGCCCGGTACCGTGAACGA