Description :
From Genome Similarity Track
Location :
Scaffold_217:23821- 25326
Transcript NameFunction/comments
Pytve_DAOMBR484fgenesh_masked-pve_contig_217-abinit-gene-0.41Kinesin K39 (ISS)

Sequence
1505 bases(100 bases per row)
AAGGGGACACAGCGAATGCAGCACACACACACACATTCACATCCGCGGCACGTCGACCATGCAGTAGCCATCGCTGCACTCACTGCTCTTGGACGCGGCC
TCGAGCGCCTGGTCGGCCGGGTCGTCGCTCGATTGGTTCGTGTCGAGATCCGGCTGTTTGACGATGCGCGTCTCGCGAATGAACTCACAGAGCGAGTTCT
TGGCCAGCTCGTCCTCCGAGAACCGCTTCTTCGGACTCTTGAGCACCATGATCTTGGTGTTGAAGCGTCGGTTCGCCTCCGCTGCGAGACGAGCCAGCGG
TCAGCACAAAGCACGGCATCCATCCTCAGGAGAGAGAGGGACACGTACTGCGGGATCGAACGCCATAGAACTGGCACACACTGTGGATCAGCAGGCGGTG
GAACGCAGAGTCCGCCAGCGGAAGCACCAGGCGGACGTCCTTCTCCGACACGTGCAGCACCTCGATCGGGTGCGTGAGGACTCGAAAGAGCGGCGCAGCC
ACCTCGAGCTCCGACGGCGCCTCGCGCCACTGCTCATCGAACACTACTGTCAGGTTCTCGTGCCTTCGTCGTGGACAGTCAGCTCCCGCCACAAAACAGC
GACGAAGCGCACCTGGACGAAGTGCAGCACCATGTACTCGACAGCCTCAATGAACGGGGCGAACGAGTTGAAGGATCGGAGCATCAACGATCGAGCGCGG
CGGTCGACGTTCATGAACATGGCCTCGGCATCTGATGGCACGGCGTCAACCGTGCGTTAGTAAACGCAACTGTGCGCAGACAGGCACGATTCAGCAGCCT
AAAACCCAACAACAACTCACGGTTCCAGTCGTCCCGGCGACGGACGCGAGGCTGGTTGGAGGAATGCTCGGCCGCAGGAACGCGGCCCTTGCGAAATGCC
GTCTGAAGATCCTGGTTCCCCGGCTCCGCCAGCTTCTGGAAGTTGGATCTGCATTGCCACCAACGTTCAGTCAAAAGGCGTGCACGGTATCGAGATGAAA
CAGGGCTTGGCGCCACTTTACCGCCACTCGACGTTGATTTGCATGTGCTCCATGAGGTCCTCGATGCGGGTCGACGCCGCCTTGTTGCCGAAATGGTGGT
CTGCCATCACACACGCGATCACTTACCGCCGCCGACAGACACACAACAAATCGACTTCGCCAAACTGCGAACGCACCGTTGAACCAGCGCTGCTGCTTGC
GCACGCCGACCGGGAGCTGGTTCGGCGCCGGCAAGTACGACACGGACCGGATCGGGTGGATGTTGATGAGCCGCTTGCTGCGCTGCAGCGGCGACTCGCT
GCGCTTCTGTGGCGTGCGCGCACGGCCCGAGCCNNNNNNNNNNNNNNNNNNNNNGCTCCGTGGCTACACCCGCATCGGCAGGCGCCTCGCTGCGCAGCGG
CGCGATCGGCCCTTCGCCCCACGCCATCTCCAGCTCCAGCTCGCTGCCGCAGAGCGACGCGACGTCGACCTCCGAGTCGCTCGGCTCGCTCACGAGCGGC
GGCGG