Description :
From Genome Similarity Track
Location :
contig_13:238203- 241175
Transcript NameFunction/comments
g2847.t1hypothetical protein

Sequence
2972 bases(100 bases per row)
GGGTCAAAGTACAGCGCATGCCAGCGCTGACGAATCGCAGAAACCACCTTGGTAACGAAAAACTCTTGTACCGCTTTCGTTTCGTTGAAAGGGATCGAAG
CTTGCAGCAACGAGCTACTCAATCTACAGATCATAGAGTAAGTTAGCTATTCCATTGGTGTATACCCCAACATGACAGCACTTACTTTTCATAGTTGACG
TAGAGCTGAAGATTGGTAGCATCGATCAGCATACCGCACCATGAGATGCACTCAGAACCTGGTGCATTGGTTGGGAGCCCCTGAGTAGCTGCAACATTCG
CTTGGCTCTTGGCAACATTGACAAAACACCCAAATTCCTCGTTGCCCTCGTGCATCACGGCGACGAACCTTCGCGCCCTCTTCAGGTCCGTCGTAATGAA
CATGAAGTCATCGGTGTACCGAAACAGCCCTTCGTGTTGACAGCAAGATACTGGTACGATGGCTGGGTCGCATACCTCAGGCAATCGTTTGCCGAGTACT
CGCCGCTCGAAATGGGCATAGTACATGTTGCACAACGTGGTGGAGAGCACGGAGCCCTGCGGGATGCCGCATCGCTGAACGTAGTCACGGCCATCGACTT
GGACGACGTTCGTAGACAAATGCTCCTTCAGCAGCTCGAGCGCTTTAGCTTTGGTCAGGTAGTCGTACAGGACACCGTCCACAAACATTGCGTTCTCTTT
CTTGGACTGCGCTGCAAGTTCTTCAAACCCCAACAATTCTCCAGACGGATATGCCGGACGCTCCAACTTGAAGAAAAACGAAGACGAAGGCAGCGATTCA
TCGCTATCTGAGATCGGAGCGACTTGGTGGCCAACCCAATGCTTGCGAATGAGATATTCATCCTCTTGTATCGCCTTCTTGAGAACCTGATACAGTTTCC
GAGGCCGTATGGTATCAAAACAACGCTCCACATCGACAGTCACGCAGTAAGCCTTTGGGGTGTCCTCTGATGCACTTCGACGCTCTTCGCATCGAGAGCA
CGAGGAGATTTCACGGAATAGAGGCTTGATGCGCTTGTAGATTTCATCCACGTTTCGGACGGAGGCCCCAACAAATCGCTTTGGCTGGCGCTCCATCTCG
AACGTCAACACTCGGTGTATGGTTTCCATGGATCTGTTCACTGAGACTTTGCCTTGGTCCACAGCCCTAGATAAATTCATCAGCGGTCGAATTCCACTCG
GTTTCGGGAGCAAGCGCAAACGAGAGGTTGCTAGCTGCCGTCTACGGTTGGCTTGCAGGGTTTTGTGGCTTGATGGTTGAAGAATGCCTCCCTGTAGATC
GTCTAGAGCAAGTGTGCTGCAACATAACAATTCAGCGCTTAGCACTTGGCAAGTCGCACCCACAGTAGCTAGCTACCCCACCTGATCACATTCCAGACTG
GACGCTGATAGAACTCGATCTCATTCGCCACTCCTTCTGCTTCTGTAATGTAAAACAGGTTTCTCAACAATGGGAAGATCAGCGACGATATCACCCACCG
CAGCACGTCTTCAAAAAGCTGTTGACGCTTGACTCGTTCATTTGGAGGGCTGAACATACCACAAATGAATTAGTTGTACCATTTTCAGGAATAACGAAAA
CCCAACACAGTACCAGAACTCCGCATTCGAGTTGGTATTCATCCATTCCACTCTCGTAACTTGAAACTCTTCAGCACACTGCACAACATAGTCAATACAG
CTTCTGTCTTGCATGGCTGAATTCCAGTCACGTACCTTCTTCAGCGAAAATATGTCGAACTTTCGGGAAAAAATGAGCTTGCGCAGCATCGACTTGACAT
ACTTCCAGTTCTTCTTTGTGTCGCTACTGCCCCACAACTCCTTAGGCACAACTCCAGCTAGCAGCTTCCGAACCAGCAGATAAATCTTCTTCTTCGGAGT
CACAAATGTCAGCATCGTCTTGATATCCTCTTTGTGCTGTTGCAGCTTTGCCACGTCTGACGTTGAGTGCGTACTGGCCCGATCTCCTGGGTTGGCCACT
GTCTTCTTAGTCTTCTTCCCCACCGGCGCTGGCATGCCGTTACCAGCTTTCGATGTCCCCACAGAAGCGTGTGACAGCATTTCAATAGCTTCCTCCCTCC
GCTTACGTTTCCGATCGCAGCTCGGAGCCACAACCTCGCTTTGGCTCGAATATCCGTCGTCAAGCGCTTTACGAACGATTGGAAGCAGGATAGGTCTCGA
TGTCGCCTCTGCATCAGCATCAGCAGTTTTCTCCGCAAGCAGTCGCTTGATGTTTGGATGATCCGCCATGAACTTACGAAACCCAGCGTGCACTGGGATT
AACTTCCTTGCGAGTTCTTCAACTTTGAACGCCTTGAATCGTGCCACCATCTCCTGGATCGTTGGAATGAGGTTAATCAGCCGCTTGGGCAAGCGCTTTC
CACCTGCAGTGTCTGGGAATATGGATCCGAGGACCCGTGAAGCTTCCGTCCGACTAATCGGCTCGCCTGTCTTGGACGCTTTCACTAGAGCGTGGGAGCT
CGCGAACACTCGATCCTTTCGAAAATGCCTCGCATACATCACGTGGTTGATCGACACTTCTCGCTTTAAAGTGGCAGTCGCGTCGCCCAGTCGCTTCTGT
TGTCGAAGACTCTTTCCAGTGAGCTAGCACACCACAAAGCACCACATTAGCTACCACATTGAACTCCCTTCTCAACCAGACAGTACTCTACCTGCATATA
CGACAGCGAGGCTTCCTTCAGTTGCACAACAATCGTGTAGTTCAATAGCAAGTGCGTCAGGAGGTCGTCCCCCATGAGCCGATGCAGAGATTCCCACAGC
GGCTTCTTCAGAGCAGCCACGAGAGTGTTCGGGTAGTAGCACATGACCCCATTGGACTGCGCCACTCGGTGGCCAGTAGCCCCGGGCGTCACTTCCCGAT
ACCCGAGGGTTAAAACGTTGGCGTCCTCCCAATTCTCCACGCCCGTTTCCGAGCCAGAAGCCGCTCGATGAC