Description :
From Genome Similarity Track
Location :
scaffold_168:2382- 3657
Sequence
1275 bases(100 bases per row)
ACCTTCCATATCCAAGCAATGCAGGCGAATTGCAACAATTCCTGTGTGCAACTAACTGGATGCGCGACAGCCTACTAGACTATGCACGAGTAATCCGACC
ACTTCAAGACGCTTTAGATACCGCATTGGCAAGTGCGTCGAAGCGAACCAAGCGGGTTGCAGCCGGAATTGCGATCCGTTTGACTTGCGATCAACAGACA
GCCTATGATGAGTTGAAACGTTTGCTGGCAAGTAGTGTTGAGCTCGCTTTCCCCCGCGCGAATGCAGTCATGTGCGTGATGACCGACGCTAGTGACGTTG
GTTGGAGCCTGATAGTGACTCAAGTTGTGAACTGGAAGTCCGACGAGCCGGTACACCAGCAGCAGCACGAACTATTGATCTGTTTAAGTGGCACATTTAC
AGGATCTCAGTGCCATTGGAGCATAATTGAAAAAGAAGCTTACCCGATAGTGTGCGCATGCGGTAGGTTGAGCTACCTTTTGCTGCGACCTGGAGGATTC
AAACTATTCTGCGATCATAGAAACCTTATCTATGTATTCGCACCGAGAGCTGAGGTGAAGAAACATATTCGCGGGAAACTGCTGCGGTGGGCGACGAAGC
TTGCTGAGTACCGGTATGAAATCGAGCATATTGAAGGAACGTCCAATGTATGGAGCGACATGGTCTCTCGCTGGGCAGGAAATCATGTCCAGGCGGCACA
TCTACAGAGGATGACACTTCGCAAAAGAGGAACAGCACCCCAACCGAACACGTCGCCCTCAAGAAAACGACAACGACGGAGACGTGGGCGTGCGCCTCAA
GCACAGCCAACAGCAAGCACGGAAACCCCACGACCCCAGCCTATACGACCATTGGATGATCCGGAATTTGAATGGCCTAACCGAGAAGCGATACTTAACT
CGCAAAGACAAAATCAGACGAGCGTGCTACAGGGAGTGACGAAAACGGTTGGTACATTGGTGACAAATTATGGATACCTGATCACGATGAAGATTTAGTT
CAGAGGATTCTAGTTATCGCTCATTGCGGACCGCAAGGTCACCGTGGAAGAGAGGCTACTCTTGAGTCGATCCGGAGATTCGTTTACCTGGTCCGCCTGA
GAGCGCGGGTGGAGAGATTTCTGTCGACTTGCTTACTATGCCACCACGTCAAAGGAAGTAAGATTATCCGAAGACCCTGGGGCGAGACATATCGAACCAG
TGAACGGAACGGTGCGCTTCACTGGGATGTCTTATTTCTTGGAGAAAGTTTTGCTGGTGATAGCTATCTATTGGT