Description :
From Genome Similarity Track
Location :
contig_13:238168- 241060
Transcript NameFunction/comments
g3000.t1hypothetical protein

Sequence
2892 bases(100 bases per row)
GGGTCAAAGTACAGCGCATGCCAGCGCTGACGAATCGCAGAAACCACCTTGGTAACGAAAAAATCTTGTACCGCTTTCGTTTCGTTGAAAGGGATCGAAG
CTTGCAGCAACGAGCTACTCAATCTACAGATCATAGAGTAAGTTAGCTATTCCATTGGTGTATACCCCAACATGACAGCACTTACTTTTCATAGTTGACG
TAGAGCTGAAGATCGGTAGCATCGATCAGCATACCGCACCATGAGATGCACTCAGAACCTGGTGCATTGGTTGGAAGCCCCTGAGTAGCTGCAAAATTCG
CTTGGCTCTTGGCAACATTGACAAAACACCCAAATTCCTCGTTGCCCTCGTGCATCACAGCGACGAACCTTCGCGCCCTCTTCAGGTCCGTCGTAATGAA
CATGAAGTCATCGGTGTACCGAAACAGCCCTTCGTGTTGACAGCAGGATACTGGTACGATGGCTGGGTCGCATACCTCAGGCAATCGTTTGCCGAGTACT
CGCCGCTCGAAATGGGCATAGTACATGTTGCACAACGTGGTGGAGAGCACGGAGCCCTGCGGGATGCCGCATCGCTGAACGTAGTCACGGCCATCGACTT
GGACGACGTTCGTAGACAAATGCTCCTTCAGCAGCTCGAGCGCTTTAGCTTTGGTCAGGTAGTCGTACAGGACACCGTCCACAAACATTGCGTTCTCTTT
CTTGGACTGCGCTGCAAGTTCTTCAAACCCCAACAATTCTCCAGACGGATATGCCGGACGCTCCAGCTTGAAGAAAAACGAAGACGAAGGCAGCAATTCA
TCGCTATCTGAGATCGGAGCGACTTGGTGGCCAACCCAATGCTTGCGAATGAGATATTCATCCTCTTGTATCGCCTTCTTGAGAACCTGATACAGTTTCC
GAGGCCGTATGGTATCAAAACAACGCTCCACATCGACAGTCACGCAGTAAGCCTTTGGGGTGCCCTTTGATGCACGTCGACGCTCTTCGCATCGAGAACA
TGAAGAGATTTCACGGAATAGAGGCTTGATGCGCTTGTAGATTTCATCCACGTTTCGGACGGAGGCCCCAACAAATCGCTTTGGCTGGCGCTCCATCTCG
AACGTCAACACTCGGTGTATGGTTTCCATGGATCTGTTCACTGAGACTTTGCCTTGGTCCACAGCCCTAGATAAATTCATCAGCGGTCGAATTCCACTCG
GTTTCGGGAGCAAGCGCAAACGAGAGGTTGCTAGCTGCCGTTTACGGTTGGCTTGCAGGGTTTTGTCGCTTGATGGTTGAAGAATGCCTCCCTGTAGATC
GTCTAGAGCAAGTGTGCTGCAACATAACAATTCAGCGCTTAGCACTTGGCAAGTCGCACCCACAGTAGCTAGCTACCCCACCTGATCACACTCCAGACTG
GACGCTGATAGAACTCGATCTCATTCGCCACTCCTTCTGCTTCTGTAATGTAAAACAGGTTTCTCAACAATGGGAAGATCAGCGACGATATCACCCACCG
CAGCACGTCTTCAAAAAGCTGTTGACGCTTGACTCGTTCATTTGGAGGGCTGAACATACCACAAATGAATTAGTTGTACCATTTTCAGGAATAATGAAAA
CCCAACACAGTACCAGAACTCCGCATTCGAGTTGGTATTCATCCATTCCACTCTCGTAACTTGAAACTCTTCAGCACACTGCACAACATAGTCAATACAG
CTTCTGTCTTGCATGGCTGAATTGCAGTCACGTACCTTCTTCAGCGAAAATATGTCGAACTTTCGGGAAAAAATGAGCTTGCGCAGCATCGACTTGACAT
ACTTCCAGTTCTTCTTTGTGTCGCTACTGCCCCACAACTCCTTAGGCACAACTCCAGCTAGCAGCTTCCGAACCAGCCGATAAATCTTCTTCTTCGGAGT
CACAAATGTCAGCATCGTCTTGATATCCTCTTTGTGCTGTTGCAGCTTTGCCACGTCTGACGTTGAGTGCGTACTGACCCGATCTCCTGGGTTGGCCACT
GTCTTCTTAGTCTTCTTCCCCACCGGCGCTGGCATGCCGTTACCAGCTTTCGATGTCCCCACAGAAGCGTGTGACAGCATTTCAATAGCTTCCTCCCTCC
GCTTACGTTTCCGATCGCAGCTCGGAGCCACAACCTCGCTTTGGCTCGAATATCCGTCGTCAAGTGCTTTACGAACGATTGGAAGCAGGATAGGTCTCGA
TGTCGCCTCTGCATCACCATCAGCAGTTTTCTCCGCAAGCATTCGCTTGATGTTTGGATGACCCGCCATGAACTTACGAAACCCAGCGTGCACTGGGATT
AACTTCCTTGCGAGCTCTTCAACTTTGAACGCCTTGAACCGTGCCACCATCTCCTGGATCGTTGGAATGAGGTTAATCAGCCGCTTGGGCAAGCGCTTTC
CACCTGCAGTGTCTGGGAATATGGATCCGAGGACCCGTGAAGCTTCCGTCCGACTAATCGGCTCGCCTGTCTTGGACGCTTTCACTAGAGCGTGGGAGCT
CGCGAACACTCGATCCTTTCGGAAATGCCTCGCATACATCACGTGGTTGATCGACACTTCTCGCTTTAAAGTGGCAGTCGCGTCGCCCAGTCGCTTCTGT
TGTCGAAGACTCTTTCCAGTGAGCTAGCACACCACAAAGCACCACATTAGCCACCACATCCAACCCCCTTCTCAACCAGACAGCACTCTACCTGCATATA
CGACAGCGAGGCTTCCTTCAGTTGCACAACAATCGTGTAGTTCAATAGCAAGTGCGTCAGGAGGTCGTCCCCCATGAGCCGATGCAGAGATTCCCACAGC
GGCTTCTTCAGAGCAGCCACGAGAGTGTTCGGGTAGTAGCACATGACCCCATTGGACTGCGCCACTCGGTGGCCAGTAGCCCCGGGCGTCAC