Description :
From Genome Similarity Track
Location :
Scaffold_997:2381- 3693
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap_masked-pug3_contig_997-abinit-gene-0.12Gene of unknown function

Sequence
1312 bases(100 bases per row)
TGTTGATGGAGTACATCCACAAGATCGCGACGCGCCTGAAATAAGAGAGCCAATTGAATTTGGATCTTGTGTTTCGAGAAGCGAGAGGCTTGGGAGAGAA
CGCGCTTGAGAGGTGGATTGCCTCCTGGCCGATTTGTGATCGTCTAACGTGAAATTGTATTTTGCTTTTCATTTCTTTTTTTTTCTCTCTCTCTCTCCGT
TTGCGGTGATGGACTACTGAGTTTGATGGAACTGATGTGTTTTCCGAACTAGAGCTATGACGTCAATGACACCACGACAAAGAAACTGGTGACAGATCGT
TGAGACCTTGGCCATGAGACTCTACTTCAACTAGACTTATCAGTTCATGAACGCGCCAAAGGGCTGCTGTGAACTCAGGAGCGCAACGTTGTTGATGTCA
CGGAAATCGTGGAGCACTGTCACAGTTTCCGTTCCCAGCGCATGTAAACCTGATGCCAAAGAATCTGTCGAAGTCGCATACTTCCGCTCCTGGAAATGCG
CATCCAGCATGTCCGTGAGGCGAGAGAGATGCGACTCCGATGACTTCTCCTTTGCTGCAGACTTTGCTCCATGGACGTCGTGGGACGATCCAAAGTACGG
CAGCACCACNNNNNNNNNNNNNNNNNNNNNNCGCGGCGTCGTCGAATGCGCATTCGGGGCCTGGGAACCACTCGTCCCGCGTGGAGAGTGGTGCGCGTCA
TTGGGTGCTATCGCGGGGAATCGGACACCAGCAGCACTGGAGTTTGTCGCGTCTGTACTTGAGTTGGCGCTAGATATACTTCGAGGCGAGGCACTGCTGC
TGGTAGAAGATGGCGCTCGACTCGCGTCGTGGAAGGGCTGTTGCTGGGCCATCATCATTCGCTGAACGTCGAGAATGGTGCAGACGTACGCCACTTCGCG
CTCGTAGGTCGGGTCGTGCAGTTTTTCGATGGCCTCATCCACTTGCGCCGCGCACTCGGCCAGTGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNCGTGCGGCAGCGCGTTGCGAACACACGCAATGCATCGATACAACCCCGATCGGGTCTCGTAAAGATCGCTGGCGACGACGAGCAGACTCT
CCCAGTACGTCACGCTCACCATCGTCGTCGGTACGTACCCGAGCTAACAAAACGCATCATCAGTAAATAAAGTTGAGGACACTTTACCCGGAACAGAGAC
TTGACTTTGGTCTCAAATGAATCAAGTGGACGTTACCTTGTGGAACGTCTCCATGGACTGTTTCCGTCGTAGCTCCGGATGCTCCATCTCGGGACTCAGG
AGTGCGCTGTGT