Description :
From Genome Similarity Track
Location :
Scaffold_92:238046- 240137
Sequence
2091 bases(100 bases per row)
GATAAGGATAACGTCTATCTGCGAAAGATCTTTATTGTCGACATTTATAGTCAGCAGGTTGATATGAAAACGAACTCAAACAAGTATCCTCGTTCGATGT
AAGTGAAAAAGCTAATTATGAGTGTGCTAGTCGAATCTACCAAGACGAGATAAAGAAATAATGCAGACCGTAGAATTGGCTCATTGCTGGACGGATATCA
AGCAGAAACCCAATTTCGTTGAATTTATGATACCTATATTATTTTTATTGATTTAATGGGGCGGGCAGCAGTTTTGGTTTCATACAATGGATTATTAAAG
AGAATATTCGAGACTTGGAGCAAGCCGATATGTTTTCGTAGAAGCTCGTTGACGAAGACTTTCAGCCGTGCACTGCCCTAGCTCTCTTAATAAAACACGG
GAAAGCAAATACGCTTGGCGATATTCTGCATGTTGGGTTTATGCACAACAAGGATGTGCACTTATGCGCTTTTTGCCTTCTACTTATTTCAGCGCTTTCA
CCTAGATCTCAAGCTGCCTCTATCTTTTTGATAATCGAAAAATGGTATGATATCAAGCTTTGAACCGTTACCGTCTTTTAGACAATCCAAAGAATGGTAT
GAAACCACTTTTTTGTGTGGGCGATATCGTACCAAGTCAATTTCTGACAACATCCACAAGAAGAACTATGAAAAAGTCTTTAAGCAACTCAGACTGGCAT
TTGATATAAAACACATACCGATCGTCAACAGGGAATTAGACAGCTCGGGAATGCTGATCCTGACGTATCTCAAACGCGAAGACAAGGTCGAAGGGGAGTC
TATTTCGCTGAAGCGGTATTTTCAGCACCTCTTGCTAGAGAAGCTGCTCAAGCTCTTTCTGGATTTCCTTGGCGAGGTCGTGGAGCGCGACATTTTACAA
CCACCAGATGAGCTAATTCAGCAAGTTTTCCGAGTCTCAAAACAAGCAAAACTTACAGGTGGAGAATGGAAATAATATTTCTGTGCGTGGTTTTATCGTG
CTACTAGAGGTTTTAAGAGTCGTGTTGCCACAATATTTATGTTTTTTATTCCCCACATTATTATTATGTTTTAAAATCATTTACTCTTTCAGTAAATATT
TAAACCTAACATGGTACCACGTAATCACCCAGGCAATATCTTCTCATATGTGCCTTCTACCTAGCTGTGGGTTGATGATACTCACTGCGTGAGGTACTTC
TTTCGCTTTACCAGCGAGTTACACCTTTGCTACGAATTCGCTTTTGACATTTTGCTGTATCCGATCGTGGTCGTAGTGGAGGCGTGTATAATATTGGAAT
GGTGATTTCTGCGTTTGATCGCACGAGTCCTGTCTGGGTGTAATGATTTGCTTTTCTTTTAAATAAAACGGTTTCTTTGCGTTGAGAGGTGACGTCATAC
TTAGATCGCTGCCCACCTTGAACCTGATCTTCTTCTTGAACAGCGTGGCAATAGTATATGTACAAAACACATCAAGTGCAGCCTGAGGAAAGCTGTCACG
TAGACCCGACAGTAAGAGGGTACTGTTTTGACCTTCCACAGCACTCGCTGTTTCTATTCTGAACAGTGACAGGGGCTCCCCGCAAATAGGGACATTTGTC
CACTCTTCTTATTCAAAACATAGTCATTTAGAATATCGGACCATTGTTTCAGGCAGGAGACTTATTGATAGCGCTTCTGACATGCAAGTCGATCAGGTCG
AGCGATAGAATAGTCGTCGTCTAGCTGAGCGATGTGTCTACTTTTGCTGATGAAGTTGCGCATCTTGTACGCCAGTCCTCAATGTCGCGATCAATTATCA
CACGCTCTGGGCCTACTGACCGTATAGAAATCTTGACACTTCGCCCAATAGTGGGCAAGTTGGCGCGAGATAAATGTCTTAACAACGCCGTGGTGGATGC
AGTTCTGTGGTACGTATCGACTTCCTGTACACTTAACCGCCAAAGTATTAGATTAACCGGTTAGAAGCGCGCAATTCATCAACCTTGTCTGTGAAAAATA
TGATTCGATTAGAAAGGAAAGGTGCTGAAGCCATCTTTTGAAGATGCTGATCGGTAACTAAAAACAATTATTATCGATATAAAGGTGCATA